Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1910-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
LINC01128
hsa-miR-1910-5p
0.930

Gene Details
Chromosome: 1
Transcript: NR_047525.1
Biotype: lincRNA
Gene id: NR_047525.1 (gene)
Gene Name: LINC01128
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
336-360
0.045
1
7mer
5548-5574
0.004
2
6mer
3373-3392
0.002
2
7mer
1589-1607
0.002
1
LINC01128
hsa-miR-1910-5p
0.930

Gene Details
Chromosome: 1
Transcript: ENST00000445118
Biotype: lincRNA
Gene id: ENSG00000228794
Gene Name: LINC01128
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
452-476
0.045
1
7mer
5664-5690
0.004
2
7mer
1705-1723
0.002
1
6mer
3489-3508
0.002
2
XLOC_009813
hsa-miR-1910-5p
0.929

Gene Details
Chromosome: chr12
Transcript: TCONS_00020482
Biotype: transcript isomorph
Gene id: XLOC_009813
Gene Name: XLOC_009813
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Lung Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1760-1784
0.053
1
XLOC_008328
hsa-miR-1910-5p
0.929

Gene Details
Chromosome: chrY
Transcript: TCONS_00017652
Biotype: transcript isomorph
Gene id: XLOC_008328
Gene Name: XLOC_008328
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Heart Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1093-1113
0.053
1
SRD5A3-AS1
hsa-miR-1910-5p
0.928

Gene Details
Chromosome: 4
Transcript: ENST00000591915
Biotype: antisense
Gene id: ENSG00000249700
Gene Name: SRD5A3-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
192-214
0.046
1
8mer
458-476
0.006
1
LINC00502
hsa-miR-1910-5p
0.927

Gene Details
Chromosome: 10
Transcript: NR_047467.2
Biotype: lincRNA
Gene id: NR_047467.2 (gene)
Gene Name: LINC00502
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
112-127
0.029
5
7mer
26-45
0.020
2
6mer
183-203
0.003
1
MAP3K14-AS1
hsa-miR-1910-5p
0.926

Gene Details
Chromosome: 17
Transcript: ENST00000585780
Biotype: antisense
Gene id: ENSG00000267278
Gene Name: MAP3K14-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2376-2392
0.048
2
7mer
304-327
0.004
1
DNM1P35
hsa-miR-1910-5p
0.923

Gene Details
Chromosome: 15
Transcript: ENST00000501931
Biotype: antisense
Gene id: ENSG00000246877
Gene Name: DNM1P35
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
205-219
0.040
2
6mer
104-127
0.005
2
6mer
358-365
0.003
2
8mer+mismatch
863-883
0.002
4
6mer
1044-1056
0.001
1
ZNF32-AS3
hsa-miR-1910-5p
0.922

Gene Details
Chromosome: 10
Transcript: NR_038867.1
Biotype: antisense
Gene id: NR_038867.1 (gene)
Gene Name: ZNF32-AS3
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
162-180
0.036
4
8mer
1314-1333
0.011
2
7mer
1269-1274
0.004
1
ADNP-AS1
hsa-miR-1910-5p
0.922

Gene Details
Chromosome: 20
Transcript: ENST00000558899
Biotype: antisense
Gene id: ENSG00000259456
Gene Name: ADNP-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
711-734
0.051
3
RP5-914P20.5
hsa-miR-1910-5p
0.922

Gene Details
Chromosome: 20
Transcript: NR_110007.1
Biotype: antisense
Gene id: NR_110007.1 (gene)
Gene Name: RP5-914P20.5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
812-835
0.051
3
LINC01128
hsa-miR-1910-5p
0.922

Gene Details
Chromosome: 1
Transcript: ENST00000449005
Biotype: lincRNA
Gene id: ENSG00000228794
Gene Name: LINC01128
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
540-564
0.051
1
ZNF32-AS3
hsa-miR-1910-5p
0.922

Gene Details
Chromosome: 10
Transcript: ENST00000458063
Biotype: antisense
Gene id: ENSG00000223910
Gene Name: ZNF32-AS3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
162-180
0.036
4
8mer
1314-1333
0.011
2
7mer
1269-1274
0.004
1
RP11-221N13.4
hsa-miR-1910-5p
0.920

Gene Details
Chromosome: 12
Transcript: ENST00000545188
Biotype: lincRNA
Gene id: ENSG00000256915
Gene Name: RP11-221N13.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
515-533
0.051
4
RP11-100F15.1
hsa-miR-1910-5p
0.916

Gene Details
Chromosome: 12
Transcript: ENST00000552413
Biotype: lincRNA
Gene id: ENSG00000257603
Gene Name: RP11-100F15.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
225-247
0.041
2
7mer
285-293
0.009
2
LINC00649
hsa-miR-1910-5p
0.916

Gene Details
Chromosome: 21
Transcript: ENST00000427447
Biotype: antisense
Gene id: ENSG00000237945
Gene Name: LINC00649
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
8561-8579
0.035
2
8mer
587-605
0.015
2
RP11-472G23.10
hsa-miR-1910-5p
0.914

Gene Details
Chromosome: 6
Transcript: ENST00000456346
Biotype: lincRNA
Gene id: ENSG00000235972
Gene Name: RP11-472G23.10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
540-564
0.029
2
7mer
113-135
0.020
2
SRD5A3-AS1
hsa-miR-1910-5p
0.913

Gene Details
Chromosome: 4
Transcript: ENST00000609500
Biotype: antisense
Gene id: ENSG00000249700
Gene Name: SRD5A3-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
525-547
0.049
1
CTD-2184D3.5
hsa-miR-1910-5p
0.913

Gene Details
Chromosome: 15
Transcript: ENST00000558607
Biotype: antisense
Gene id: ENSG00000259712
Gene Name: CTD-2184D3.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
72-95
0.034
2
6mer
20-34
0.009
2
6mer
488-510
0.006
2
AP003774.6
hsa-miR-1910-5p
0.910

Gene Details
Chromosome: 11
Transcript: ENST00000457725
Biotype: lincRNA
Gene id: ENSG00000231680
Gene Name: AP003774.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
465-484
0.039
2
7mer
893-910
0.007
1
6mer
423-444
0.003
1
Funded by: