Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1910-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
LOC100129917
hsa-miR-1910-5p
0.909

Gene Details
Chromosome: 4
Transcript: NR_036512.1
Biotype: lincRNA
Gene id: NR_036512.1 (gene)
Gene Name: LOC100129917
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
392-413
0.048
2
RP11-440L14.1
hsa-miR-1910-5p
0.907

Gene Details
Chromosome: 4
Transcript: ENST00000503185
Biotype: antisense
Gene id: ENSG00000249592
Gene Name: RP11-440L14.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
392-413
0.048
2
RP11-440L14.1
hsa-miR-1910-5p
0.906

Gene Details
Chromosome: 4
Transcript: ENST00000503405
Biotype: antisense
Gene id: ENSG00000249592
Gene Name: RP11-440L14.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
295-316
0.048
2
SRD5A3-AS1
hsa-miR-1910-5p
0.906

Gene Details
Chromosome: 4
Transcript: ENST00000599135
Biotype: antisense
Gene id: ENSG00000249700
Gene Name: SRD5A3-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
192-214
0.040
1
8mer
340-358
0.008
1
RP11-582E3.2
hsa-miR-1910-5p
0.904

Gene Details
Chromosome: 12
Transcript: ENST00000538920
Biotype: lincRNA
Gene id: ENSG00000256226
Gene Name: RP11-582E3.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
276-294
0.043
2
6mer
74-89
0.004
1
FAM87A
hsa-miR-1910-5p
0.902

Gene Details
Chromosome: 8
Transcript: ENST00000602608
Biotype: lincRNA
Gene id: ENSG00000182366
Gene Name: FAM87A
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1218-1237
0.043
2
6mer
664-679
0.004
2
XLOC_012724
hsa-miR-1910-5p
0.900

Gene Details
Chromosome: chr18
Transcript: TCONS_00026372
Biotype: transcript isomorph
Gene id: XLOC_012724
Gene Name: XLOC_012724
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Heart Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
185-205
0.047
5
XLOC_012526
hsa-miR-1910-5p
0.899

Gene Details
Chromosome: chr17
Transcript: TCONS_00025698
Biotype: transcript isomorph
Gene id: XLOC_012526
Gene Name: XLOC_012526
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Liver Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
565-589
0.046
2
RP11-866E20.3
hsa-miR-1910-5p
0.897

Gene Details
Chromosome: 18
Transcript: ENST00000585691
Biotype: lincRNA
Gene id: ENSG00000267462
Gene Name: RP11-866E20.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1402-1411
0.046
2
XLOC_013064
hsa-miR-1910-5p
0.897

Gene Details
Chromosome: chr19
Transcript: TCONS_00027536
Biotype: transcript isomorph
Gene id: XLOC_013064
Gene Name: XLOC_013064
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2507-2528
0.014
1
7mer
804-819
0.009
2
6mer
1775-1785
0.008
2
7mer
1825-1841
0.008
2
6mer
1543-1564
0.007
2
RP11-285E9.6
hsa-miR-1910-5p
0.894

Gene Details
Chromosome: 17
Transcript: ENST00000581657
Biotype: lincRNA
Gene id: ENSG00000263718
Gene Name: RP11-285E9.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
167-183
0.046
2
LINC00960
hsa-miR-1910-5p
0.894

Gene Details
Chromosome: 3
Transcript: ENST00000463183
Biotype: lincRNA
Gene id: ENSG00000242516
Gene Name: LINC00960
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
629-650
0.029
1
6mer
822-847
0.011
2
6mer
1014-1038
0.005
1
LINC00663
hsa-miR-1910-5p
0.893

Gene Details
Chromosome: 19
Transcript: ENST00000586645
Biotype: lincRNA
Gene id: ENSG00000266904
Gene Name: LINC00663
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
83-109
0.035
1
6mer
130-147
0.008
1
7mer
938-960
0.002
Not Conserved
RP11-48F14.1
hsa-miR-1910-5p
0.891

Gene Details
Chromosome: 3
Transcript: ENST00000441169
Biotype: lincRNA
Gene id: ENSG00000224406
Gene Name: RP11-48F14.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Lung Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
448-454
0.020
1
9mer
15-31
0.018
1
7mer
443-454
0.007
1
LINC00969
hsa-miR-1910-5p
0.890

Gene Details
Chromosome: 3
Transcript: ENST00000598992
Biotype: lincRNA
Gene id: ENSG00000242086
Gene Name: LINC00969
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
967-984
0.038
1
6mer
61-82
0.004
1
6mer
569-583
0.003
2
AC079466.1
hsa-miR-1910-5p
0.888

Gene Details
Chromosome: 19
Transcript: ENST00000587961
Biotype: lincRNA
Gene id: ENSG00000266976
Gene Name: AC079466.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2224-2236
0.020
2
7mer
2621-2642
0.008
2
7mer
2005-2017
0.007
2
6mer
1898-1910
0.005
2
6mer
1491-1502
0.004
2
XLOC_001621
hsa-miR-1910-5p
0.888

Gene Details
Chromosome: chr2
Transcript: TCONS_00003817
Biotype: transcript isomorph
Gene id: XLOC_001621
Gene Name: XLOC_001621
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
547-566
0.019
1
8mer
1068-1090
0.018
1
6mer
674-695
0.007
2
TRG-AS1
hsa-miR-1910-5p
0.886

Gene Details
Chromosome: 7
Transcript: NR_040085.1
Biotype: lincRNA
Gene id: NR_040085.1 (gene)
Gene Name: TRG-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
177-182
0.017
2
7mer
268-289
0.014
2
7mer
375-394
0.013
2
RP11-335L23.5
hsa-miR-1910-5p
0.885

Gene Details
Chromosome: 4
Transcript: ENST00000610012
Biotype: lincRNA
Gene id: ENSG00000272784
Gene Name: RP11-335L23.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
366-380
0.044
4
MIR4534
hsa-miR-1910-5p
0.884

Gene Details
Chromosome: 22
Transcript: ENST00000623111
Biotype: sense_overlapping
Gene id: ENSG00000279010
Gene Name: MIR4534
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
22277-22296
0.005
1
8mer
39615-39630
0.004
2
7mer
19736-19745
0.003
9
7mer
25182-25203
0.003
8
7mer
34893-34901
0.002
2
7mer
4366-4381
0.002
2
6mer
29927-29953
0.002
4
6mer
27485-27507
0.002
3
6mer
15881-15904
0.002
3
8mer
24448-24469
0.001
2
6mer
8790-8813
0.001
1
7mer
5544-5566
0.001
2
7mer
42192-42217
0.001
1
6mer
38027-38044
0.001
3
6mer
4666-4692
0.001
Not Conserved
7mer
41366-41382
0.001
2
6mer
9787-9799
0.001
1
6mer
39456-39462
0.001
1
6mer
27969-27983
0.001
2
6mer
29470-29478
0.001
2
7mer
22662-22687
0.001
1
6mer
3082-3099
0.001
2
6mer
48129-48153
0.001
2
6mer
30173-30191
0.001
2
6mer
31142-31155
0.001
1
6mer
34042-34059
0.001
1
6mer
31870-31897
0.001
2
6mer
28068-28088
0.001
2
Funded by: