Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1910-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RPARP-AS1
hsa-miR-1910-5p
0.883

Gene Details
Chromosome: 10
Transcript: ENST00000598368
Biotype: retained_intron
Gene id: ENSG00000269609
Gene Name: RPARP-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1972-1986
0.022
2
8mer
2415-2422
0.022
1
RP11-348N5.7
hsa-miR-1910-5p
0.880

Gene Details
Chromosome: 10
Transcript: ENST00000603915
Biotype: antisense
Gene id: ENSG00000270589
Gene Name: RP11-348N5.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
236-253
0.043
5
RP11-1086F11.1
hsa-miR-1910-5p
0.877

Gene Details
Chromosome: 1
Transcript: ENST00000417786
Biotype: sense_intronic
Gene id: ENSG00000225300
Gene Name: RP11-1086F11.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
474-486
0.023
2
7mer
39-60
0.012
1
7mer
1589-1614
0.009
1
RP13-653N12.1
hsa-miR-1910-5p
0.877

Gene Details
Chromosome: 12
Transcript: ENST00000536341
Biotype: lincRNA
Gene id: ENSG00000256551
Gene Name: RP13-653N12.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
243-260
0.043
2
MUC19
hsa-miR-1910-5p
0.876

Gene Details
Chromosome: 12
Transcript: ENST00000454784
Biotype: processed_transcript
Gene id: ENSG00000205592
Gene Name: MUC19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Testes Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
24277-24302
0.008
4
8mer
7436-7458
0.006
1
7mer
21636-21662
0.005
2
6mer
24019-24034
0.005
7
7mer
20664-20690
0.004
1
8mer
3165-3182
0.004
1
6mer
22291-22310
0.001
2
6mer
8501-8522
0.001
2
6mer
11867-11882
0.001
Not Conserved
6mer
20442-20453
0.001
1
6mer
8707-8729
0.001
2
6mer
18763-18789
0.001
1
6mer
20788-20807
0.001
2
6mer
10036-10062
0.001
1
6mer
17853-17875
0.001
1
6mer
21757-21776
0.001
1
6mer
10670-10692
0.001
Not Conserved
6mer
13477-13498
0.000
Not Conserved
6mer
10161-10182
0.000
Not Conserved
RP11-854K16.3
hsa-miR-1910-5p
0.876

Gene Details
Chromosome: 15
Transcript: ENST00000568414
Biotype: lincRNA
Gene id: ENSG00000260986
Gene Name: RP11-854K16.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
114-122
0.021
1
6mer
160-185
0.021
1
RP4-806M20.5
hsa-miR-1910-5p
0.875

Gene Details
Chromosome: 20
Transcript: ENST00000603095
Biotype: lincRNA
Gene id: ENSG00000270279
Gene Name: RP4-806M20.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1381-1402
0.037
1
8mer
931-953
0.006
1
XLOC_003861
hsa-miR-1910-5p
0.874

Gene Details
Chromosome: chr4
Transcript: TCONS_00007369
Biotype: transcript isomorph
Gene id: XLOC_003861
Gene Name: XLOC_003861
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Prostate Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
159-178
0.042
2
VIPR1-AS1
hsa-miR-1910-5p
0.873

Gene Details
Chromosome: 3
Transcript: ENST00000610022
Biotype: antisense
Gene id: ENSG00000232354
Gene Name: VIPR1-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
196-219
0.027
4
7mer
28-33
0.009
2
7mer
156-183
0.006
3
RP3-513G18.2
hsa-miR-1910-5p
0.873

Gene Details
Chromosome: 4
Transcript: ENST00000508619
Biotype: lincRNA
Gene id: ENSG00000250632
Gene Name: RP3-513G18.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
160-179
0.042
2
RP11-488C13.5
hsa-miR-1910-5p
0.871

Gene Details
Chromosome: 14
Transcript: ENST00000554058
Biotype: lincRNA
Gene id: ENSG00000258301
Gene Name: RP11-488C13.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
37-58
0.030
6
7mer
470-478
0.008
3
7mer
656-678
0.005
2
VIPR1-AS1
hsa-miR-1910-5p
0.871

Gene Details
Chromosome: 3
Transcript: ENST00000608869
Biotype: antisense
Gene id: ENSG00000232354
Gene Name: VIPR1-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
249-272
0.026
4
7mer
36-41
0.009
2
7mer
164-185
0.007
3
RP11-727A23.5
hsa-miR-1910-5p
0.871

Gene Details
Chromosome: 11
Transcript: ENST00000500634
Biotype: lincRNA
Gene id: ENSG00000247137
Gene Name: RP11-727A23.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
690-707
0.038
7
7mer
268-293
0.004
Not Conserved
AC006548.28
hsa-miR-1910-5p
0.867

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
70709-70715
0.009
1
8mer
62861-62882
0.004
2
7mer
29625-29634
0.003
2
7mer
34926-34945
0.003
2
7mer
6797-6813
0.003
2
8mer
13896-13909
0.003
3
6mer
944-958
0.002
Not Conserved
6mer
1466-1480
0.002
2
6mer
25417-25424
0.002
1
6mer
84030-84047
0.002
2
6mer
60886-60893
0.002
1
7mer
38966-38990
0.001
2
6mer
863-874
0.001
Not Conserved
8mer
10018-10035
0.001
1
7mer
15288-15302
0.001
1
6mer
13954-13979
0.001
1
6mer
7176-7198
0.001
2
6mer
38351-38376
0.001
3
6mer
9091-9105
0.000
Not Conserved
6mer
9077-9100
0.000
Not Conserved
6mer
9084-9105
0.000
Not Conserved
XLOC_001068
hsa-miR-1910-5p
0.866

Gene Details
Chromosome: chr1
Transcript: TCONS_00000653
Biotype: transcript isomorph
Gene id: XLOC_001068
Gene Name: XLOC_001068
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
81-93
0.036
3
6mer
339-354
0.005
2
RP11-311H10.4
hsa-miR-1910-5p
0.865

Gene Details
Chromosome: 9
Transcript: ENST00000450864
Biotype: antisense
Gene id: ENSG00000223678
Gene Name: RP11-311H10.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
14-35
0.038
1
6mer
218-240
0.003
3
LINC00910
hsa-miR-1910-5p
0.865

Gene Details
Chromosome: 17
Transcript: ENST00000592135
Biotype: lincRNA
Gene id: ENSG00000188825
Gene Name: LINC00910
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2211-2236
0.034
3
7mer
954-978
0.007
2
CKMT2-AS1
hsa-miR-1910-5p
0.863

Gene Details
Chromosome: 5
Transcript: ENST00000502041
Biotype: antisense
Gene id: ENSG00000247572
Gene Name: CKMT2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
235-260
0.021
1
7mer
1674-1698
0.016
2
6mer
649-661
0.002
1
6mer
1098-1118
0.002
2
GRK5-IT1
hsa-miR-1910-5p
0.862

Gene Details
Chromosome: 10
Transcript: ENST00000421206
Biotype: sense_intronic
Gene id: ENSG00000228485
Gene Name: GRK5-IT1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
269-294
0.041
1
XLOC_010133
hsa-miR-1910-5p
0.861

Gene Details
Chromosome: chr12
Transcript: TCONS_00020848
Biotype: transcript isomorph
Gene id: XLOC_010133
Gene Name: XLOC_010133
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Breast Normal/Primary
HepG2 Liver Cancer/Malignant
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
612-636
0.041
1
Funded by: