Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1910-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RPARP-AS1
hsa-miR-1910-5p
0.860

Gene Details
Chromosome: 10
Transcript: ENST00000492465
Biotype: lincRNA
Gene id: ENSG00000269609
Gene Name: RPARP-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1517-1524
0.020
1
8mer
1074-1088
0.020
2
XLOC_009546
hsa-miR-1910-5p
0.860

Gene Details
Chromosome: chr11
Transcript: TCONS_00019752
Biotype: transcript isomorph
Gene id: XLOC_009546
Gene Name: XLOC_009546
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
142-168
0.040
2
SRD5A3-AS1
hsa-miR-1910-5p
0.859

Gene Details
Chromosome: 4
Transcript: ENST00000596312
Biotype: antisense
Gene id: ENSG00000249700
Gene Name: SRD5A3-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
565-587
0.040
1
LINC00960
hsa-miR-1910-5p
0.859

Gene Details
Chromosome: 3
Transcript: NR_040005.1
Biotype: lincRNA
Gene id: NR_040005.1 (gene)
Gene Name: LINC00960
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
739-760
0.035
1
6mer
963-987
0.005
1
SRD5A3-AS1
hsa-miR-1910-5p
0.858

Gene Details
Chromosome: 4
Transcript: ENST00000595734
Biotype: antisense
Gene id: ENSG00000249700
Gene Name: SRD5A3-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
565-587
0.035
1
6mer
821-830
0.005
2
CTD-2410N18.3
hsa-miR-1910-5p
0.858

Gene Details
Chromosome: 5
Transcript: ENST00000602919
Biotype: lincRNA
Gene id: ENSG00000270177
Gene Name: CTD-2410N18.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1065-1090
0.038
5
6mer
1122-1136
0.002
2
CTD-2006H14.2
hsa-miR-1910-5p
0.857

Gene Details
Chromosome: 8
Transcript: ENST00000607706
Biotype: antisense
Gene id: ENSG00000271971
Gene Name: CTD-2006H14.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
418-436
0.040
5
AC004538.3
hsa-miR-1910-5p
0.857

Gene Details
Chromosome: 7
Transcript: ENST00000599875
Biotype: antisense
Gene id: ENSG00000230333
Gene Name: AC004538.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
382-394
0.040
2
XLOC_009888
hsa-miR-1910-5p
0.856

Gene Details
Chromosome: chr12
Transcript: TCONS_00020569
Biotype: transcript isomorph
Gene id: XLOC_009888
Gene Name: XLOC_009888
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
212-234
0.034
2
7mer
272-280
0.006
2
XLOC_000166
hsa-miR-1910-5p
0.856

Gene Details
Chromosome: chr1
Transcript: TCONS_00002016
Biotype: transcript isomorph
Gene id: XLOC_000166
Gene Name: XLOC_000166
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
168-187
0.040
4
XLOC_008014
hsa-miR-1910-5p
0.856

Gene Details
Chromosome: chrX
Transcript: TCONS_00017432
Biotype: transcript isomorph
Gene id: XLOC_008014
Gene Name: XLOC_008014
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
174-200
0.033
2
6mer
260-272
0.007
5
RP11-727A23.5
hsa-miR-1910-5p
0.855

Gene Details
Chromosome: 11
Transcript: ENST00000529607
Biotype: lincRNA
Gene id: ENSG00000247137
Gene Name: RP11-727A23.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
359-376
0.040
7
TCL6
hsa-miR-1910-5p
0.854

Gene Details
Chromosome: 14
Transcript: ENST00000486671
Biotype: retained_intron
Gene id: ENSG00000187621
Gene Name: TCL6
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2432-2440
0.036
7
8mer+wobble
397-418
0.004
2
CTD-2147F2.2
hsa-miR-1910-5p
0.853

Gene Details
Chromosome: 15
Transcript: ENST00000558621
Biotype: lincRNA
Gene id: ENSG00000259664
Gene Name: CTD-2147F2.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1041-1066
0.039
2
LOC100129034
hsa-miR-1910-5p
0.852

Gene Details
Chromosome: 9
Transcript: NR_027406.1
Biotype: antisense
Gene id: NR_027406.1 (gene)
Gene Name: LOC100129034
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
5386-5404
0.014
2
7mer
177-201
0.010
3
6mer
127-150
0.006
4
7mer
329-345
0.005
2
6mer
5500-5518
0.004
3
6mer
1465-1478
0.001
2
LINC00960
hsa-miR-1910-5p
0.852

Gene Details
Chromosome: 3
Transcript: ENST00000492922
Biotype: lincRNA
Gene id: ENSG00000242516
Gene Name: LINC00960
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1396-1417
0.029
1
6mer
1589-1614
0.011
2
SRD5A3-AS1
hsa-miR-1910-5p
0.852

Gene Details
Chromosome: 4
Transcript: ENST00000595103
Biotype: antisense
Gene id: ENSG00000249700
Gene Name: SRD5A3-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
401-423
0.039
1
LOC100131289
hsa-miR-1910-5p
0.852

Gene Details
Chromosome: 6
Transcript: NR_038929.1
Biotype: lincRNA
Gene id: NR_038929.1 (gene)
Gene Name: LOC100131289
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
170-183
0.023
2
6mer
176-201
0.008
2
6mer
340-364
0.005
2
6mer
196-211
0.003
1
LOC100505761
hsa-miR-1910-5p
0.852

Gene Details
Chromosome: 10
Transcript: NR_038938.1
Biotype: antisense
Gene id: NR_038938.1 (gene)
Gene Name: LOC100505761
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1268-1275
0.020
1
8mer
825-839
0.019
2
RPARP-AS1
hsa-miR-1910-5p
0.849

Gene Details
Chromosome: 10
Transcript: ENST00000473970
Biotype: lincRNA
Gene id: ENSG00000269609
Gene Name: RPARP-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1254-1261
0.020
1
8mer
811-825
0.019
2
Funded by: