Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1910-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_012139
hsa-miR-1910-5p
0.848

Gene Details
Chromosome: chr17
Transcript: TCONS_00025161
Biotype: transcript isomorph
Gene id: XLOC_012139
Gene Name: XLOC_012139
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
71-94
0.020
2
7mer
521-536
0.019
2
RP11-342D11.3
hsa-miR-1910-5p
0.848

Gene Details
Chromosome: 10
Transcript: ENST00000414308
Biotype: lincRNA
Gene id: ENSG00000233387
Gene Name: RP11-342D11.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Lymph Node Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
493-510
0.028
1
7mer
372-381
0.010
1
RP11-32K4.1
hsa-miR-1910-5p
0.847

Gene Details
Chromosome: 8
Transcript: ENST00000521958
Biotype: antisense
Gene id: ENSG00000253554
Gene Name: RP11-32K4.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
373-396
0.039
8
RP11-727A23.5
hsa-miR-1910-5p
0.847

Gene Details
Chromosome: 11
Transcript: ENST00000529811
Biotype: lincRNA
Gene id: ENSG00000247137
Gene Name: RP11-727A23.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
285-302
0.039
7
VAC14-AS1
hsa-miR-1910-5p
0.846

Gene Details
Chromosome: 16
Transcript: ENST00000562507
Biotype: antisense
Gene id: ENSG00000214353
Gene Name: VAC14-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
4634-4650
0.011
1
8mer
4645-4667
0.010
1
7mer
198-211
0.009
2
8mer
779-801
0.003
1
6mer
310-332
0.003
1
6mer
101-122
0.002
2
6mer
2127-2148
0.001
2
RP11-32K4.1
hsa-miR-1910-5p
0.846

Gene Details
Chromosome: 8
Transcript: ENST00000523191
Biotype: antisense
Gene id: ENSG00000253554
Gene Name: RP11-32K4.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
367-390
0.039
8
XLOC_008029
hsa-miR-1910-5p
0.846

Gene Details
Chromosome: chrX
Transcript: TCONS_00017217
Biotype: transcript isomorph
Gene id: XLOC_008029
Gene Name: XLOC_008029
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Lung Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
145-161
0.039
4
CTB-13F3.1
hsa-miR-1910-5p
0.845

Gene Details
Chromosome: 7
Transcript: ENST00000608515
Biotype: antisense
Gene id: ENSG00000273055
Gene Name: CTB-13F3.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
515-539
0.036
1
6mer
403-427
0.003
1
RP5-856G1.2
hsa-miR-1910-5p
0.844

Gene Details
Chromosome: 6
Transcript: ENST00000314040
Biotype: lincRNA
Gene id: ENSG00000176515
Gene Name: RP5-856G1.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
39-59
0.034
Not Conserved
6mer
2808-2833
0.005
5
RP11-1060G2.1
hsa-miR-1910-5p
0.843

Gene Details
Chromosome: 12
Transcript: ENST00000550687
Biotype: antisense
Gene id: ENSG00000257283
Gene Name: RP11-1060G2.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
478-504
0.033
2
6mer
313-322
0.006
2
MALAT1
hsa-miR-1910-5p
0.842

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2401-2417
0.012
2
8mer
778-796
0.008
2
7mer
2710-2722
0.006
6
6mer
6652-6674
0.005
9
7mer
3887-3910
0.004
4
6mer
395-412
0.002
2
6mer
6859-6875
0.001
2
RP11-445O3.3
hsa-miR-1910-5p
0.842

Gene Details
Chromosome: 5
Transcript: ENST00000562127
Biotype: lincRNA
Gene id: ENSG00000260763
Gene Name: RP11-445O3.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
878-900
0.021
1
6mer
3268-3286
0.017
1
AC003958.2
hsa-miR-1910-5p
0.839

Gene Details
Chromosome: 17
Transcript: ENST00000432258
Biotype: antisense
Gene id: ENSG00000234859
Gene Name: AC003958.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2898-2911
0.020
8
8mer
2078-2095
0.016
7
6mer
3125-3149
0.002
Not Conserved
CTD-2378E12.1
hsa-miR-1910-5p
0.838

Gene Details
Chromosome: 15
Transcript: ENST00000619889
Biotype: lincRNA
Gene id: ENSG00000273674
Gene Name: CTD-2378E12.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
370-385
0.027
2
8mer
27-48
0.011
1
RP11-344E13.3
hsa-miR-1910-5p
0.837

Gene Details
Chromosome: 17
Transcript: ENST00000443508
Biotype: antisense
Gene id: ENSG00000233098
Gene Name: RP11-344E13.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
51-74
0.021
2
7mer
501-516
0.017
2
XLOC_004366
hsa-miR-1910-5p
0.837

Gene Details
Chromosome: chr5
Transcript: TCONS_00009941
Biotype: transcript isomorph
Gene id: XLOC_004366
Gene Name: XLOC_004366
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
11813-11836
0.013
2
8mer
3221-3244
0.007
2
8mer
12737-12762
0.006
1
7mer
2044-2062
0.003
1
8mer
4865-4883
0.002
1
7mer
7556-7577
0.002
1
6mer
6275-6301
0.001
1
7mer
1391-1410
0.001
2
6mer
2189-2211
0.001
1
6mer
5703-5722
0.001
1
XLOC_007166
hsa-miR-1910-5p
0.836

Gene Details
Chromosome: chr8
Transcript: TCONS_00015109
Biotype: transcript isomorph
Gene id: XLOC_007166
Gene Name: XLOC_007166
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4535-4560
0.030
2
7mer
2203-2215
0.007
2
CKMT2-AS1
hsa-miR-1910-5p
0.835

Gene Details
Chromosome: 5
Transcript: ENST00000500148
Biotype: antisense
Gene id: ENSG00000247572
Gene Name: CKMT2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
235-260
0.021
1
7mer
1674-1698
0.013
2
6mer
649-661
0.002
1
6mer
1098-1118
0.001
2
CTC-281M20.4
hsa-miR-1910-5p
0.835

Gene Details
Chromosome: 5
Transcript: ENST00000507398
Biotype: lincRNA
Gene id: ENSG00000249403
Gene Name: CTC-281M20.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
313-320
0.037
2
SRD5A3-AS1
hsa-miR-1910-5p
0.834

Gene Details
Chromosome: 4
Transcript: ENST00000596289
Biotype: antisense
Gene id: ENSG00000249700
Gene Name: SRD5A3-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
565-587
0.037
1
Funded by: