Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1910-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-119B16.2
hsa-miR-1910-5p
0.833

Gene Details
Chromosome: 20
Transcript: ENST00000451507
Biotype: antisense
Gene id: ENSG00000229539
Gene Name: RP11-119B16.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
344-369
0.029
6
8mer
287-303
0.005
1
6mer
172-190
0.003
2
YEATS2-AS1
hsa-miR-1910-5p
0.833

Gene Details
Chromosome: 3
Transcript: ENST00000425008
Biotype: antisense
Gene id: ENSG00000233885
Gene Name: YEATS2-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
6-19
0.023
2
7mer
106-117
0.014
1
AC114776.3
hsa-miR-1910-5p
0.833

Gene Details
Chromosome: 2
Transcript: ENST00000414159
Biotype: lincRNA
Gene id: ENSG00000235881
Gene Name: AC114776.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
3070-3088
0.021
2
6mer
3435-3459
0.006
2
6mer
3179-3204
0.006
2
6mer
3735-3753
0.004
Not Conserved
XLOC_000392
hsa-miR-1910-5p
0.832

Gene Details
Chromosome: chr1
Transcript: TCONS_00000301
Biotype: transcript isomorph
Gene id: XLOC_000392
Gene Name: XLOC_000392
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
787-805
0.031
2
7mer
882-901
0.006
2
RP11-381O7.3
hsa-miR-1910-5p
0.831

Gene Details
Chromosome: 9
Transcript: ENST00000598595
Biotype: lincRNA
Gene id: ENSG00000182021
Gene Name: RP11-381O7.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2038-2059
0.035
2
6mer
1553-1570
0.001
1
AC078941.1
hsa-miR-1910-5p
0.831

Gene Details
Chromosome: 2
Transcript: ENST00000433133
Biotype: lincRNA
Gene id: ENSG00000236780
Gene Name: AC078941.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Lung Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1795-1814
0.037
2
RP11-727A23.5
hsa-miR-1910-5p
0.830

Gene Details
Chromosome: 11
Transcript: ENST00000528083
Biotype: lincRNA
Gene id: ENSG00000247137
Gene Name: RP11-727A23.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
360-377
0.032
7
7mer
132-157
0.004
Not Conserved
RP11-238K6.1
hsa-miR-1910-5p
0.830

Gene Details
Chromosome: 8
Transcript: ENST00000518973
Biotype: lincRNA
Gene id: ENSG00000253288
Gene Name: RP11-238K6.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3575-3596
0.023
2
6mer
3694-3718
0.006
1
6mer
563-581
0.004
2
6mer
2776-2791
0.002
1
6mer
1201-1209
0.002
1
RP11-379K22.3
hsa-miR-1910-5p
0.828

Gene Details
Chromosome: 15
Transcript: ENST00000603875
Biotype: antisense
Gene id: ENSG00000270919
Gene Name: RP11-379K22.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
421-442
0.036
9
XLOC_010984
hsa-miR-1910-5p
0.828

Gene Details
Chromosome: chr14
Transcript: TCONS_00022692
Biotype: transcript isomorph
Gene id: XLOC_010984
Gene Name: XLOC_010984
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Placenta Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
183-199
0.020
1
7mer
109-127
0.016
2
LL22NC03-22D1.1
hsa-miR-1910-5p
0.828

Gene Details
Chromosome: 22
Transcript: ENST00000624601
Biotype: lincRNA
Gene id: ENSG00000279003
Gene Name: LL22NC03-22D1.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
9352-9375
0.010
2
7mer
6770-6790
0.007
3
8mer
15269-15291
0.005
1
7mer
10737-10750
0.004
1
7mer
27672-27692
0.003
2
6mer
28831-28845
0.002
1
6mer
25091-25105
0.002
3
6mer
27610-27629
0.002
1
6mer
10076-10090
0.001
Not Conserved
6mer
27678-27702
0.000
1
KB-1991G8.1
hsa-miR-1910-5p
0.827

Gene Details
Chromosome: 8
Transcript: ENST00000519566
Biotype: lincRNA
Gene id: ENSG00000253217
Gene Name: KB-1991G8.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
176-201
0.031
2
6mer
57-76
0.005
3
CTC-529L17.2
hsa-miR-1910-5p
0.826

Gene Details
Chromosome: 5
Transcript: ENST00000503489
Biotype: lincRNA
Gene id: ENSG00000249984
Gene Name: CTC-529L17.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
547-572
0.036
9
RP1-269M15.3
hsa-miR-1910-5p
0.825

Gene Details
Chromosome: 20
Transcript: ENST00000430025
Biotype: lincRNA
Gene id: ENSG00000233508
Gene Name: RP1-269M15.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
597-616
0.019
2
7mer
545-566
0.017
3
RP11-727A23.5
hsa-miR-1910-5p
0.824

Gene Details
Chromosome: 11
Transcript: ENST00000528524
Biotype: lincRNA
Gene id: ENSG00000247137
Gene Name: RP11-727A23.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
231-248
0.036
7
LINC00910
hsa-miR-1910-5p
0.824

Gene Details
Chromosome: 17
Transcript: ENST00000588654
Biotype: lincRNA
Gene id: ENSG00000188825
Gene Name: LINC00910
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
170-195
0.036
3
IQCH-AS1
hsa-miR-1910-5p
0.823

Gene Details
Chromosome: 15
Transcript: ENST00000561232
Biotype: lincRNA
Gene id: ENSG00000259673
Gene Name: IQCH-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
148-169
0.032
3
6mer
11-22
0.003
2
RP11-1102P16.1
hsa-miR-1910-5p
0.823

Gene Details
Chromosome: 8
Transcript: ENST00000523327
Biotype: lincRNA
Gene id: ENSG00000253379
Gene Name: RP11-1102P16.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
278-302
0.036
7
SRD5A3-AS1
hsa-miR-1910-5p
0.822

Gene Details
Chromosome: 4
Transcript: ENST00000609700
Biotype: antisense
Gene id: ENSG00000249700
Gene Name: SRD5A3-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
343-365
0.036
1
WISP1-OT1
hsa-miR-1910-5p
0.822

Gene Details
Chromosome: 8
Transcript: ENST00000602893
Biotype: sense_intronic
Gene id: ENSG00000270132
Gene Name: WISP1-OT1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
538-551
0.028
3
6mer
161-183
0.005
3
6mer
140-152
0.002
Not Conserved
Funded by: