Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1910-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
U95743.1
hsa-miR-1910-5p
0.822

Gene Details
Chromosome: 16
Transcript: ENST00000573369
Biotype: lincRNA
Gene id: ENSG00000262267
Gene Name: U95743.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
586-609
0.036
4
IQCH-AS1
hsa-miR-1910-5p
0.821

Gene Details
Chromosome: 15
Transcript: ENST00000559298
Biotype: lincRNA
Gene id: ENSG00000259673
Gene Name: IQCH-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
148-169
0.032
3
6mer
11-22
0.003
2
RP11-340I6.8
hsa-miR-1910-5p
0.821

Gene Details
Chromosome: 7
Transcript: ENST00000450544
Biotype: lincRNA
Gene id: ENSG00000226581
Gene Name: RP11-340I6.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
73-93
0.021
1
6mer
232-236
0.015
1
LOC285819
hsa-miR-1910-5p
0.820

Gene Details
Chromosome: 6
Transcript: NR_038992.1
Biotype: antisense
Gene id: NR_038992.1 (gene)
Gene Name: LOC285819
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
38-51
0.031
2
7mer
1054-1080
0.005
1
VAC14-AS1
hsa-miR-1910-5p
0.820

Gene Details
Chromosome: 16
Transcript: ENST00000398177
Biotype: antisense
Gene id: ENSG00000214353
Gene Name: VAC14-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1935-1951
0.011
1
8mer
1946-1968
0.010
1
7mer
163-176
0.009
2
6mer
275-297
0.003
1
6mer
66-87
0.002
2
LINC00969
hsa-miR-1910-5p
0.816

Gene Details
Chromosome: 3
Transcript: ENST00000597482
Biotype: lincRNA
Gene id: ENSG00000242086
Gene Name: LINC00969
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1196-1213
0.029
1
6mer
61-82
0.004
1
6mer
569-583
0.002
2
AC012507.3
hsa-miR-1910-5p
0.816

Gene Details
Chromosome: 2
Transcript: ENST00000415628
Biotype: antisense
Gene id: ENSG00000232520
Gene Name: AC012507.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
97-122
0.009
2
7mer
371-394
0.007
2
6mer
1557-1565
0.005
2
7mer
547-565
0.004
Not Conserved
7mer
625-644
0.003
2
8mer
143-163
0.003
1
6mer
1465-1483
0.002
1
8mer
590-614
0.002
Not Conserved
AC012370.3
hsa-miR-1910-5p
0.815

Gene Details
Chromosome: 2
Transcript: ENST00000613621
Biotype: lincRNA
Gene id: ENSG00000234255
Gene Name: AC012370.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
17-33
0.035
4
RP11-953B20.1
hsa-miR-1910-5p
0.815

Gene Details
Chromosome: 8
Transcript: ENST00000562989
Biotype: lincRNA
Gene id: ENSG00000261710
Gene Name: RP11-953B20.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1172-1193
0.015
2
8mer
527-541
0.014
1
7mer
973-990
0.006
1
RP11-104J23.1
hsa-miR-1910-5p
0.815

Gene Details
Chromosome: 17
Transcript: ENST00000617328
Biotype: antisense
Gene id: ENSG00000275944
Gene Name: RP11-104J23.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
244-269
0.028
1
6mer
168-193
0.007
1
VIPR1-AS1
hsa-miR-1910-5p
0.813

Gene Details
Chromosome: 3
Transcript: ENST00000452639
Biotype: antisense
Gene id: ENSG00000232354
Gene Name: VIPR1-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1406-1429
0.016
4
7mer
544-568
0.007
2
7mer
728-733
0.004
2
6mer
1055-1064
0.003
2
7mer
856-877
0.003
3
7mer
931-952
0.002
1
SRD5A3-AS1
hsa-miR-1910-5p
0.811

Gene Details
Chromosome: 4
Transcript: ENST00000609051
Biotype: antisense
Gene id: ENSG00000249700
Gene Name: SRD5A3-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
509-531
0.035
1
LINC00937
hsa-miR-1910-5p
0.810

Gene Details
Chromosome: 12
Transcript: ENST00000537659
Biotype: lincRNA
Gene id: ENSG00000226091
Gene Name: LINC00937
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
554-570
0.034
3
AC004862.6
hsa-miR-1910-5p
0.810

Gene Details
Chromosome: 7
Transcript: ENST00000619137
Biotype: antisense
Gene id: ENSG00000232667
Gene Name: AC004862.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
153-171
0.034
2
RORB-AS1
hsa-miR-1910-5p
0.808

Gene Details
Chromosome: 9
Transcript: ENST00000417576
Biotype: antisense
Gene id: ENSG00000224825
Gene Name: RORB-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
293-311
0.029
2
7mer
1151-1170
0.005
1
RP11-1072N2.3
hsa-miR-1910-5p
0.808

Gene Details
Chromosome: 5
Transcript: ENST00000510049
Biotype: lincRNA
Gene id: ENSG00000249792
Gene Name: RP11-1072N2.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
64-76
0.034
2
SRD5A3-AS1
hsa-miR-1910-5p
0.808

Gene Details
Chromosome: 4
Transcript: ENST00000609487
Biotype: antisense
Gene id: ENSG00000249700
Gene Name: SRD5A3-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
345-367
0.034
1
AF064858.6
hsa-miR-1910-5p
0.807

Gene Details
Chromosome: 21
Transcript: ENST00000380931
Biotype: lincRNA
Gene id: ENSG00000205622
Gene Name: AF064858.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
173-191
0.022
1
7mer
650-669
0.011
1
6mer
3246-3263
0.001
1
AC005154.6
hsa-miR-1910-5p
0.807

Gene Details
Chromosome: 7
Transcript: ENST00000584621
Biotype: antisense
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
348-372
0.032
2
6mer
261-286
0.002
Not Conserved
SRD5A3-AS1
hsa-miR-1910-5p
0.806

Gene Details
Chromosome: 4
Transcript: ENST00000609573
Biotype: antisense
Gene id: ENSG00000249700
Gene Name: SRD5A3-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
502-524
0.034
1
Funded by: