Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-29b-3p

ENST00000609510
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AP000350.5
hsa-miR-29b-3p
0.404

Gene Details
Chromosome: 22
Transcript: ENST00000609510
Biotype: lincRNA
Gene id: ENSG00000273295
Gene Name: AP000350.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1188-1203
0.003
1
6mer
1428-1450
0.001
1
Funded by: