Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-29b-3p

ENST00000623130
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AC006548.28
hsa-miR-29b-3p
0.998

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
45671-45684
0.013
Not Conserved
7mer
72855-72870
0.012
2
8mer
3272-3286
0.009
3
8mer
2019-2033
0.008
2
8mer
47796-47822
0.007
Not Conserved
8mer
71349-71369
0.007
Not Conserved
7mer
33824-33843
0.005
1
8mer
8096-8114
0.004
2
7mer
40616-40628
0.004
2
7mer
27647-27669
0.003
2
7mer
13498-13518
0.003
2
7mer
53302-53324
0.003
Not Conserved
7mer
63086-63104
0.002
2
7mer
62068-62084
0.002
1
7mer
37153-37175
0.002
1
8mer+mismatch
3672-3691
0.002
2
7mer
38169-38195
0.002
Not Conserved
7mer
13111-13132
0.002
2
6mer
42397-42414
0.002
1
6mer
77062-77079
0.002
Not Conserved
6mer
17924-17944
0.001
2
6mer
76747-76762
0.001
1
6mer
53615-53632
0.001
Not Conserved
7mer
23617-23637
0.001
1
6mer
23724-23743
0.001
3
6mer
6447-6460
0.001
2
6mer
64350-64366
0.001
2
6mer
25465-25488
0.001
2
6mer
22464-22477
0.001
2
6mer
61864-61886
0.001
1
6mer
45361-45386
0.001
Not Conserved
6mer
47213-47234
0.001
Not Conserved
6mer
62370-62389
0.001
2
6mer
10537-10562
0.001
2
6mer
17785-17801
0.001
2
6mer
3153-3169
0.001
1
6mer
63043-63068
0.000
1
6mer
40549-40563
0.000
2
Funded by: