Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-30b-3p

ENST00000438659
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AC008281.1
hsa-miR-30b-3p
0.470

Gene Details
Chromosome: 2
Transcript: ENST00000438659
Biotype: lincRNA
Gene id: ENSG00000228909
Gene Name: AC008281.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
522-542
0.006
4
6mer
203-218
0.003
2
Funded by: