Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-30b-3p

ENST00000608023
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
C1orf132
hsa-miR-30b-3p
0.965

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
10119-10142
0.018
2
8mer
14413-14436
0.008
4
8mer
7938-7961
0.008
2
7mer
4299-4310
0.006
2
7mer
14121-14145
0.005
2
7mer
2571-2586
0.003
2
6mer
4558-4581
0.003
7
7mer
5770-5791
0.002
2
8mer
10979-10994
0.002
Not Conserved
6mer
3630-3656
0.002
1
6mer
9646-9664
0.001
3
6mer
5256-5277
0.001
4
6mer
10816-10831
0.001
2
7mer
5227-5249
0.001
1
6mer
9166-9189
0.001
2
6mer
12997-13011
0.001
2
6mer
9576-9588
0.001
2
6mer
2441-2466
0.001
3
Funded by: