Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-30b-3p

ENST00000619486
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
CTA-315H11.2
hsa-miR-30b-3p
0.679

Gene Details
Chromosome: 7
Transcript: ENST00000619486
Biotype: sense_intronic
Gene id: ENSG00000274080
Gene Name: CTA-315H11.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
2165-2180
0.005
3
6mer
543-565
0.003
4
6mer
251-275
0.003
1
6mer
1830-1857
0.003
1
6mer
1121-1140
0.003
2
6mer
1345-1367
0.002
2
6mer
1695-1717
0.002
1
6mer
683-705
0.001
2
Funded by: