Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-30b-3p

NR_037616.1
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
BLOC1S5-TXNDC5
hsa-miR-30b-3p
0.625

Gene Details
Chromosome: 6
Transcript: NR_037616.1
Biotype: sense
Gene id: NR_037616.1 (gene)
Gene Name: BLOC1S5-TXNDC5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
598-609
0.017
4
6mer
997-1023
0.001
3
6mer
1810-1836
0.001
1
Funded by: