Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-34b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-310H4.3
hsa-miR-34b-3p
0.815

Gene Details
Chromosome: 7
Transcript: ENST00000449899
Biotype: lincRNA
Gene id: ENSG00000231394
Gene Name: RP11-310H4.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Lymph Node Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
407-429
0.020
2
6mer
366-388
0.015
2
LA16c-306A4.1
hsa-miR-34b-3p
0.815

Gene Details
Chromosome: 16
Transcript: ENST00000569106
Biotype: antisense
Gene id: ENSG00000260022
Gene Name: LA16c-306A4.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
34-57
0.018
2
6mer
57-68
0.016
2
RP11-140I24.1
hsa-miR-34b-3p
0.813

Gene Details
Chromosome: 16
Transcript: ENST00000554640
Biotype: lincRNA
Gene id: ENSG00000258779
Gene Name: RP11-140I24.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2200-2223
0.013
1
8mer
216-237
0.013
2
6mer
641-645
0.009
7
GRIK1-AS2
hsa-miR-34b-3p
0.812

Gene Details
Chromosome: 21
Transcript: NR_033368.1
Biotype: sense
Gene id: NR_033368.1 (gene)
Gene Name: GRIK1-AS2
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
132-148
0.024
5
6mer
1036-1059
0.006
1
6mer
96-116
0.005
1
XLOC_010749
hsa-miR-34b-3p
0.811

Gene Details
Chromosome: chr14
Transcript: TCONS_00022343
Biotype: transcript isomorph
Gene id: XLOC_010749
Gene Name: XLOC_010749
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
212-235
0.019
1
6mer
688-714
0.009
1
6mer
37-41
0.006
1
CTA-212A2.3
hsa-miR-34b-3p
0.811

Gene Details
Chromosome: 22
Transcript: ENST00000624264
Biotype: lincRNA
Gene id: ENSG00000279217
Gene Name: CTA-212A2.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
318-331
0.008
1
8mer
6378-6384
0.006
2
7mer
9738-9751
0.005
2
7mer
13248-13253
0.005
1
7mer
11478-11491
0.004
2
7mer
12018-12030
0.003
Not Conserved
6mer
5664-5668
0.002
1
6mer
12986-13006
0.001
1
6mer
12177-12198
0.001
1
RP11-337N6.3
hsa-miR-34b-3p
0.810

Gene Details
Chromosome: 2
Transcript: ENST00000624891
Biotype: sense_intronic
Gene id: ENSG00000280374
Gene Name: RP11-337N6.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
107-132
0.028
1
6mer
201-211
0.006
2
LINC00701
hsa-miR-34b-3p
0.810

Gene Details
Chromosome: 10
Transcript: NR_038884.1
Biotype: lincRNA
Gene id: NR_038884.1 (gene)
Gene Name: LINC00701
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
123-128
0.022
9
8mer
1639-1650
0.005
1
6mer
694-712
0.004
5
7mer
4050-4056
0.002
Not Conserved
LOC284581
hsa-miR-34b-3p
0.810

Gene Details
Chromosome: 1
Transcript: NR_046097.1
Biotype: lincRNA
Gene id: NR_046097.1 (gene)
Gene Name: LOC284581
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
1990-2008
0.014
2
6mer
1550-1563
0.011
2
6mer
1994-2021
0.009
2
RP11-337C18.9
hsa-miR-34b-3p
0.809

Gene Details
Chromosome: 1
Transcript: ENST00000606152
Biotype: antisense
Gene id: ENSG00000271721
Gene Name: RP11-337C18.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
641-660
0.017
1
8mer
348-372
0.009
1
6mer
1763-1773
0.005
2
6mer
905-909
0.003
2
RP11-138H8.8
hsa-miR-34b-3p
0.808

Gene Details
Chromosome: 15
Transcript: ENST00000621778
Biotype: sense_intronic
Gene id: ENSG00000274297
Gene Name: RP11-138H8.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
561-579
0.034
2
SNHG14
hsa-miR-34b-3p
0.808

Gene Details
Chromosome: 15
Transcript: ENST00000551631
Biotype: antisense
Gene id: ENSG00000224078
Gene Name: SNHG14
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
125-151
0.013
2
6mer
3896-3921
0.010
2
7mer
2317-2336
0.005
2
6mer
899-909
0.004
2
6mer
1441-1452
0.002
1
LINC00238
hsa-miR-34b-3p
0.808

Gene Details
Chromosome: 14
Transcript: ENST00000359454
Biotype: lincRNA
Gene id: ENSG00000196553
Gene Name: LINC00238
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
651-664
0.034
7
AL022344.7
hsa-miR-34b-3p
0.808

Gene Details
Chromosome: 10
Transcript: ENST00000568976
Biotype: lincRNA
Gene id: ENSG00000259869
Gene Name: AL022344.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
742-764
0.018
1
6mer
698-725
0.016
1
XLOC_013866
hsa-miR-34b-3p
0.807

Gene Details
Chromosome: chr21
Transcript: TCONS_00028969
Biotype: transcript isomorph
Gene id: XLOC_013866
Gene Name: XLOC_013866
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
205-231
0.012
1
6mer
4230-4253
0.011
7
6mer
729-733
0.004
2
6mer
3846-3860
0.004
1
6mer
3921-3925
0.003
2
LINC01224
hsa-miR-34b-3p
0.806

Gene Details
Chromosome: 19
Transcript: ENST00000601293
Biotype: lincRNA
Gene id: ENSG00000269416
Gene Name: LINC01224
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
16-33
0.017
2
6mer
55-77
0.017
2
RP11-63D14.1
hsa-miR-34b-3p
0.804

Gene Details
Chromosome: 11
Transcript: ENST00000526554
Biotype: lincRNA
Gene id: ENSG00000255477
Gene Name: RP11-63D14.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
100-124
0.034
2
RP11-244B22.6
hsa-miR-34b-3p
0.803

Gene Details
Chromosome: 16
Transcript: ENST00000564059
Biotype: lincRNA
Gene id: ENSG00000261398
Gene Name: RP11-244B22.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
874-897
0.021
1
6mer
1045-1070
0.013
1
CTA-414D7.1
hsa-miR-34b-3p
0.802

Gene Details
Chromosome: 22
Transcript: ENST00000623440
Biotype: sense_intronic
Gene id: ENSG00000279175
Gene Name: CTA-414D7.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
6470-6479
0.018
7
8mer
8162-8178
0.013
2
6mer
3926-3930
0.002
2
RP11-932A10.1
hsa-miR-34b-3p
0.802

Gene Details
Chromosome: 14
Transcript: ENST00000556602
Biotype: lincRNA
Gene id: ENSG00000259008
Gene Name: RP11-932A10.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
3830-3846
0.022
1
7mer
727-732
0.006
4
7mer
1857-1871
0.006
4
Funded by: