Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-34b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RMST
hsa-miR-34b-3p
0.801

Gene Details
Chromosome: 12
Transcript: ENST00000552411
Biotype: retained_intron
Gene id: ENSG00000255794
Gene Name: RMST
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
605-622
0.021
7
6mer
45-61
0.012
11
LINC00238
hsa-miR-34b-3p
0.801

Gene Details
Chromosome: 14
Transcript: ENST00000411796
Biotype: lincRNA
Gene id: ENSG00000196553
Gene Name: LINC00238
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
612-625
0.033
7
CTD-2216M2.1
hsa-miR-34b-3p
0.800

Gene Details
Chromosome: 11
Transcript: ENST00000531681
Biotype: antisense
Gene id: ENSG00000254710
Gene Name: CTD-2216M2.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
596-622
0.033
3
HIF1A-AS2
hsa-miR-34b-3p
0.800

Gene Details
Chromosome: 14
Transcript: NR_045406.1
Biotype: antisense
Gene id: NR_045406.1 (gene)
Gene Name: HIF1A-AS2
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1885-1904
0.033
2
DDR1-AS1
hsa-miR-34b-3p
0.799

Gene Details
Chromosome: 6
Transcript: ENST00000458361
Biotype: antisense
Gene id: ENSG00000237775
Gene Name: DDR1-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
520-534
0.019
2
7mer
586-609
0.007
2
7mer
1238-1256
0.005
1
6mer
3465-3489
0.002
Not Conserved
SOX2-OT
hsa-miR-34b-3p
0.798

Gene Details
Chromosome: 3
Transcript: ENST00000477928
Biotype: sense_overlapping
Gene id: ENSG00000242808
Gene Name: SOX2-OT
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
874-889
0.033
1
RP11-962G15.1
hsa-miR-34b-3p
0.797

Gene Details
Chromosome: 8
Transcript: ENST00000519451
Biotype: lincRNA
Gene id: ENSG00000253363
Gene Name: RP11-962G15.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
16-33
0.033
2
XLOC_007155
hsa-miR-34b-3p
0.795

Gene Details
Chromosome: chr8
Transcript: TCONS_00015093
Biotype: transcript isomorph
Gene id: XLOC_007155
Gene Name: XLOC_007155
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
1683-1701
0.011
6
7mer
695-701
0.008
4
7mer
969-993
0.008
2
6mer
536-540
0.005
3
LINC00971
hsa-miR-34b-3p
0.795

Gene Details
Chromosome: 3
Transcript: ENST00000484892
Biotype: lincRNA
Gene id: ENSG00000242641
Gene Name: LINC00971
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2187-2205
0.008
2
7mer
3615-3635
0.006
2
8mer
4212-4218
0.005
Not Conserved
7mer
5929-5944
0.003
2
6mer
180-198
0.003
1
6mer
4000-4020
0.003
3
6mer
1722-1742
0.002
2
6mer
4876-4880
0.002
3
RP11-128P17.4
hsa-miR-34b-3p
0.795

Gene Details
Chromosome: 18
Transcript: ENST00000609980
Biotype: lincRNA
Gene id: ENSG00000273119
Gene Name: RP11-128P17.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
556-563
0.033
3
LINC01085
hsa-miR-34b-3p
0.795

Gene Details
Chromosome: 4
Transcript: ENST00000502759
Biotype: lincRNA
Gene id: ENSG00000248698
Gene Name: LINC01085
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1563-1579
0.030
3
6mer
1102-1115
0.003
2
AC007036.5
hsa-miR-34b-3p
0.794

Gene Details
Chromosome: 7
Transcript: ENST00000511893
Biotype: sense_overlapping
Gene id: ENSG00000251660
Gene Name: AC007036.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
371-397
0.009
3
6mer
95-114
0.007
6
7mer
175-196
0.007
1
6mer
65-87
0.005
4
6mer
349-371
0.004
3
RP11-344E13.3
hsa-miR-34b-3p
0.793

Gene Details
Chromosome: 17
Transcript: ENST00000579168
Biotype: antisense
Gene id: ENSG00000233098
Gene Name: RP11-344E13.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
38-55
0.016
1
6mer
389-412
0.016
1
AC006007.1
hsa-miR-34b-3p
0.792

Gene Details
Chromosome: 7
Transcript: ENST00000422084
Biotype: lincRNA
Gene id: ENSG00000230746
Gene Name: AC006007.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Colon Normal/Primary
- Prostate Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
528-546
0.033
1
LINC01362
hsa-miR-34b-3p
0.792

Gene Details
Chromosome: 1
Transcript: ENST00000452901
Biotype: lincRNA
Gene id: ENSG00000230817
Gene Name: LINC01362
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
51-64
0.022
3
7mer
58-81
0.010
2
PCAT19
hsa-miR-34b-3p
0.792

Gene Details
Chromosome: 19
Transcript: ENST00000594315
Biotype: lincRNA
Gene id: ENSG00000267107
Gene Name: PCAT19
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
946-960
0.033
2
MIR124-2HG
hsa-miR-34b-3p
0.792

Gene Details
Chromosome: 8
Transcript: ENST00000521441
Biotype: lincRNA
Gene id: ENSG00000254377
Gene Name: MIR124-2HG
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
143-160
0.027
2
7mer
1811-1829
0.006
1
SNHG14
hsa-miR-34b-3p
0.792

Gene Details
Chromosome: 15
Transcript: ENST00000557108
Biotype: retained_intron
Gene id: ENSG00000224078
Gene Name: SNHG14
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
780-807
0.022
2
7mer
1099-1125
0.006
2
6mer
863-872
0.004
4
RP11-15H20.6
hsa-miR-34b-3p
0.791

Gene Details
Chromosome: 19
Transcript: ENST00000397094
Biotype: lincRNA
Gene id: ENSG00000213971
Gene Name: RP11-15H20.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
1464-1489
0.015
2
6mer
252-263
0.013
2
6mer
1398-1416
0.004
1
RP11-508N22.12
hsa-miR-34b-3p
0.791

Gene Details
Chromosome: 10
Transcript: ENST00000608335
Biotype: lincRNA
Gene id: ENSG00000272983
Gene Name: RP11-508N22.12
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3961-3988
0.009
2
7mer
5893-5917
0.008
1
6mer
6204-6208
0.007
2
7mer
2124-2137
0.005
1
6mer
5239-5266
0.004
2
Funded by: