Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-34b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_012515
hsa-miR-34b-3p
0.790

Gene Details
Chromosome: chr17
Transcript: TCONS_00025694
Biotype: transcript isomorph
Gene id: XLOC_012515
Gene Name: XLOC_012515
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
69-88
0.020
2
7mer
513-518
0.007
1
6mer
178-193
0.005
2
AC096649.2
hsa-miR-34b-3p
0.790

Gene Details
Chromosome: 2
Transcript: ENST00000449168
Biotype: antisense
Gene id: ENSG00000229750
Gene Name: AC096649.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
467-485
0.017
10
6mer
363-382
0.011
7
6mer
272-295
0.004
5
CTD-3234P18.6
hsa-miR-34b-3p
0.790

Gene Details
Chromosome: 19
Transcript: ENST00000611182
Biotype: lincRNA
Gene id: ENSG00000276071
Gene Name: CTD-3234P18.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
1162-1184
0.013
3
7mer
668-693
0.013
2
7mer
272-293
0.007
2
LL22NC03-2H8.5
hsa-miR-34b-3p
0.789

Gene Details
Chromosome: 22
Transcript: ENST00000610778
Biotype: lincRNA
Gene id: ENSG00000274422
Gene Name: LL22NC03-2H8.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
256-266
0.032
1
HYMAI
hsa-miR-34b-3p
0.789

Gene Details
Chromosome: 6
Transcript: NR_002768.1
Biotype: sense
Gene id: NR_002768.1 (gene)
Gene Name: HYMAI
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
3498-3509
0.014
6
7mer
4951-4969
0.005
1
7mer
1717-1740
0.005
4
6mer
927-945
0.004
2
6mer
382-398
0.004
2
XLOC_012004
hsa-miR-34b-3p
0.789

Gene Details
Chromosome: chr16
Transcript: TCONS_00025047
Biotype: transcript isomorph
Gene id: XLOC_012004
Gene Name: XLOC_012004
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
161-174
0.027
6
6mer
859-863
0.006
8
RGPD4-AS1
hsa-miR-34b-3p
0.789

Gene Details
Chromosome: 2
Transcript: ENST00000609972
Biotype: lincRNA
Gene id: ENSG00000230651
Gene Name: RGPD4-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
241-261
0.029
Not Conserved
6mer
322-336
0.003
Not Conserved
CTD-2139B15.4
hsa-miR-34b-3p
0.789

Gene Details
Chromosome: 5
Transcript: ENST00000505158
Biotype: lincRNA
Gene id: ENSG00000250822
Gene Name: CTD-2139B15.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
387-399
0.026
5
6mer
356-380
0.006
4
XLOC_014019
hsa-miR-34b-3p
0.789

Gene Details
Chromosome: chr21
Transcript: TCONS_00029091
Biotype: transcript isomorph
Gene id: XLOC_014019
Gene Name: XLOC_014019
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
620-645
0.020
2
7mer
3790-3802
0.009
2
6mer
3674-3694
0.003
2
RP11-312J18.6
hsa-miR-34b-3p
0.788

Gene Details
Chromosome: 1
Transcript: ENST00000427339
Biotype: lincRNA
Gene id: ENSG00000232188
Gene Name: RP11-312J18.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Lung Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
127-151
0.032
1
MIR124-2HG
hsa-miR-34b-3p
0.788

Gene Details
Chromosome: 8
Transcript: ENST00000520799
Biotype: lincRNA
Gene id: ENSG00000254377
Gene Name: MIR124-2HG
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
143-160
0.027
2
6mer
852-864
0.006
4
XLOC_007446
hsa-miR-34b-3p
0.787

Gene Details
Chromosome: chr9
Transcript: TCONS_00016056
Biotype: transcript isomorph
Gene id: XLOC_007446
Gene Name: XLOC_007446
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
91-107
0.032
2
TMEM44-AS1
hsa-miR-34b-3p
0.787

Gene Details
Chromosome: 3
Transcript: ENST00000453671
Biotype: antisense
Gene id: ENSG00000231770
Gene Name: TMEM44-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1095-1109
0.032
2
RP11-356J5.12
hsa-miR-34b-3p
0.787

Gene Details
Chromosome: 11
Transcript: ENST00000419895
Biotype: lincRNA
Gene id: ENSG00000250303
Gene Name: RP11-356J5.12
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1051-1077
0.022
7
6mer
1552-1556
0.007
3
6mer
199-223
0.003
Not Conserved
RP11-160E2.16
hsa-miR-34b-3p
0.786

Gene Details
Chromosome: 17
Transcript: ENST00000447506
Biotype: lincRNA
Gene id: ENSG00000236022
Gene Name: RP11-160E2.16
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
360-384
0.021
3
6mer
39-62
0.011
2
RP11-431M3.2
hsa-miR-34b-3p
0.786

Gene Details
Chromosome: 8
Transcript: ENST00000518178
Biotype: lincRNA
Gene id: ENSG00000254033
Gene Name: RP11-431M3.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
308-314
0.032
2
RP11-160E2.17
hsa-miR-34b-3p
0.786

Gene Details
Chromosome: 17
Transcript: ENST00000439868
Biotype: lincRNA
Gene id: ENSG00000230197
Gene Name: RP11-160E2.17
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
360-384
0.021
3
6mer
39-62
0.011
2
RP11-594N15.2
hsa-miR-34b-3p
0.786

Gene Details
Chromosome: 8
Transcript: ENST00000519242
Biotype: lincRNA
Gene id: ENSG00000254266
Gene Name: RP11-594N15.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
558-572
0.016
1
7mer
615-634
0.012
2
7mer
509-530
0.004
2
RP11-524N5.1
hsa-miR-34b-3p
0.785

Gene Details
Chromosome: 5
Transcript: ENST00000619068
Biotype: lincRNA
Gene id: ENSG00000276778
Gene Name: RP11-524N5.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3052-3058
0.020
7
7mer
2904-2921
0.006
2
7mer
2413-2437
0.006
2
RHOA-IT1
hsa-miR-34b-3p
0.785

Gene Details
Chromosome: 3
Transcript: ENST00000428083
Biotype: sense_intronic
Gene id: ENSG00000235908
Gene Name: RHOA-IT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
322-345
0.022
1
6mer
124-139
0.006
1
6mer
120-139
0.005
1
Funded by: