Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-34b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
LINC01312
hsa-miR-34b-3p
0.785

Gene Details
Chromosome: 6
Transcript: ENST00000456347
Biotype: lincRNA
Gene id: ENSG00000223586
Gene Name: LINC01312
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
223-229
0.032
3
XLOC_000269
hsa-miR-34b-3p
0.783

Gene Details
Chromosome: chr1
Transcript: TCONS_00000242
Biotype: transcript isomorph
Gene id: XLOC_000269
Gene Name: XLOC_000269
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
51-64
0.022
3
7mer
58-81
0.010
2
LINC00641
hsa-miR-34b-3p
0.782

Gene Details
Chromosome: 14
Transcript: ENST00000555688
Biotype: lincRNA
Gene id: ENSG00000258441
Gene Name: LINC00641
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
402-407
0.020
3
6mer
661-682
0.006
4
6mer
188-203
0.005
1
XLOC_010967
hsa-miR-34b-3p
0.782

Gene Details
Chromosome: chr14
Transcript: TCONS_00022406
Biotype: transcript isomorph
Gene id: XLOC_010967
Gene Name: XLOC_010967
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
401-406
0.020
3
6mer
660-681
0.006
4
6mer
187-202
0.005
1
LINC00663
hsa-miR-34b-3p
0.780

Gene Details
Chromosome: 19
Transcript: ENST00000586885
Biotype: lincRNA
Gene id: ENSG00000266904
Gene Name: LINC00663
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
27-39
0.028
1
6mer
1442-1465
0.004
1
SLC2A1-AS1
hsa-miR-34b-3p
0.780

Gene Details
Chromosome: 1
Transcript: ENST00000416689
Biotype: retained_intron
Gene id: ENSG00000227533
Gene Name: SLC2A1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2711-2732
0.017
1
8mer
1414-1439
0.011
2
6mer
1153-1165
0.003
2
XIST
hsa-miR-34b-3p
0.780

Gene Details
Chromosome: X
Transcript: ENST00000429829
Biotype: lincRNA
Gene id: ENSG00000229807
Gene Name: XIST
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
18175-18199
0.004
1
6mer
6808-6830
0.003
5
7mer
13247-13268
0.003
1
6mer
12398-12417
0.003
3
6mer
11513-11533
0.003
2
6mer
12093-12112
0.002
2
6mer
6990-7001
0.002
2
6mer
11223-11242
0.002
2
6mer
2770-2782
0.002
2
6mer
11804-11823
0.002
2
6mer
3856-3871
0.002
2
6mer
3039-3054
0.002
2
6mer
12972-12989
0.001
1
6mer
12686-12705
0.001
1
XLOC_002882
hsa-miR-34b-3p
0.780

Gene Details
Chromosome: chr3
Transcript: TCONS_00006281
Biotype: transcript isomorph
Gene id: XLOC_002882
Gene Name: XLOC_002882
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
5619-5645
0.013
2
7mer
1657-1683
0.006
4
7mer
2386-2397
0.004
2
6mer
564-583
0.003
2
6mer
301-327
0.003
1
6mer
4102-4119
0.002
2
RP11-238F2.1
hsa-miR-34b-3p
0.780

Gene Details
Chromosome: 17
Transcript: ENST00000605009
Biotype: lincRNA
Gene id: ENSG00000271239
Gene Name: RP11-238F2.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
226-243
0.031
4
LOC284581
hsa-miR-34b-3p
0.779

Gene Details
Chromosome: 1
Transcript: NR_046098.1
Biotype: lincRNA
Gene id: NR_046098.1 (gene)
Gene Name: LOC284581
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
1638-1656
0.012
2
6mer
1198-1211
0.011
2
6mer
1642-1669
0.008
2
XLOC_004283
hsa-miR-34b-3p
0.778

Gene Details
Chromosome: chr5
Transcript: TCONS_00009346
Biotype: transcript isomorph
Gene id: XLOC_004283
Gene Name: XLOC_004283
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
689-710
0.021
2
6mer
16-41
0.011
2
NLGN1-AS1
hsa-miR-34b-3p
0.778

Gene Details
Chromosome: 3
Transcript: ENST00000457192
Biotype: antisense
Gene id: ENSG00000228213
Gene Name: NLGN1-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
14-21
0.031
2
RP11-82O19.1
hsa-miR-34b-3p
0.778

Gene Details
Chromosome: 17
Transcript: ENST00000577846
Biotype: antisense
Gene id: ENSG00000263657
Gene Name: RP11-82O19.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
459-466
0.031
2
HOXA10-HOXA9
hsa-miR-34b-3p
0.777

Gene Details
Chromosome: 7
Transcript: NR_037940.1
Biotype: sense
Gene id: NR_037940.1 (gene)
Gene Name: HOXA10-HOXA9
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1596-1620
0.009
2
7mer
640-662
0.007
8
7mer
1512-1521
0.006
8
6mer
213-233
0.006
2
6mer
679-699
0.003
1
PTENP1-AS
hsa-miR-34b-3p
0.777

Gene Details
Chromosome: 9
Transcript: NR_103745.1
Biotype: lincRNA
Gene id: NR_103745.1 (gene)
Gene Name: PTENP1-AS
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
453-478
0.031
2
LINC00882
hsa-miR-34b-3p
0.776

Gene Details
Chromosome: 3
Transcript: ENST00000484698
Biotype: lincRNA
Gene id: ENSG00000242759
Gene Name: LINC00882
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
624-643
0.015
2
6mer
2545-2566
0.007
3
8mer
1075-1100
0.005
2
6mer
858-874
0.003
2
6mer
1919-1945
0.002
Not Conserved
CDKN2B-AS1
hsa-miR-34b-3p
0.776

Gene Details
Chromosome: 9
Transcript: ENST00000585267
Biotype: antisense
Gene id: ENSG00000240498
Gene Name: CDKN2B-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1314-1332
0.016
4
7mer
681-700
0.015
4
TTTY4B
hsa-miR-34b-3p
0.776

Gene Details
Chromosome: Y
Transcript: ENST00000420149
Biotype: lincRNA
Gene id: ENSG00000235412
Gene Name: TTTY4B
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
474-493
0.031
1
XLOC_008302
hsa-miR-34b-3p
0.776

Gene Details
Chromosome: chrY
Transcript: TCONS_00017581
Biotype: transcript isomorph
Gene id: XLOC_008302
Gene Name: XLOC_008302
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
474-493
0.031
1
TTTY4
hsa-miR-34b-3p
0.776

Gene Details
Chromosome: Y
Transcript: ENST00000436568
Biotype: lincRNA
Gene id: ENSG00000226906
Gene Name: TTTY4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
474-493
0.031
1
Funded by: