Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-34b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-307O13.1
hsa-miR-34b-3p
0.775

Gene Details
Chromosome: 13
Transcript: ENST00000568811
Biotype: lincRNA
Gene id: ENSG00000261728
Gene Name: RP11-307O13.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2192-2204
0.020
2
7mer
1943-1957
0.007
2
6mer
1226-1244
0.004
3
XLOC_010962
hsa-miR-34b-3p
0.775

Gene Details
Chromosome: chr14
Transcript: TCONS_00022361
Biotype: transcript isomorph
Gene id: XLOC_010962
Gene Name: XLOC_010962
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
491-514
0.016
1
6mer
12-38
0.009
1
6mer
685-689
0.006
1
TTTY4C
hsa-miR-34b-3p
0.775

Gene Details
Chromosome: Y
Transcript: ENST00000456123
Biotype: lincRNA
Gene id: ENSG00000228296
Gene Name: TTTY4C
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
854-873
0.031
1
XLOC_008332
hsa-miR-34b-3p
0.775

Gene Details
Chromosome: chrY
Transcript: TCONS_00017595
Biotype: transcript isomorph
Gene id: XLOC_008332
Gene Name: XLOC_008332
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
853-872
0.031
1
XLOC_008301
hsa-miR-34b-3p
0.775

Gene Details
Chromosome: chrY
Transcript: TCONS_00017580
Biotype: transcript isomorph
Gene id: XLOC_008301
Gene Name: XLOC_008301
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
474-493
0.031
1
RP11-510D19.1
hsa-miR-34b-3p
0.775

Gene Details
Chromosome: 18
Transcript: ENST00000566582
Biotype: lincRNA
Gene id: ENSG00000260676
Gene Name: RP11-510D19.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
406-413
0.024
1
6mer
1212-1227
0.004
2
6mer
838-851
0.003
2
CTC-550B14.7
hsa-miR-34b-3p
0.775

Gene Details
Chromosome: 19
Transcript: ENST00000586845
Biotype: antisense
Gene id: ENSG00000267265
Gene Name: CTC-550B14.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
115-126
0.031
2
RP1-309H15.2
hsa-miR-34b-3p
0.775

Gene Details
Chromosome: 6
Transcript: ENST00000427775
Biotype: lincRNA
Gene id: ENSG00000228772
Gene Name: RP1-309H15.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
225-236
0.023
4
6mer
220-236
0.008
5
KCNIP4-IT1
hsa-miR-34b-3p
0.773

Gene Details
Chromosome: 4
Transcript: NR_002813.1
Biotype: sense
Gene id: NR_002813.1 (gene)
Gene Name: KCNIP4-IT1
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
9635-9648
0.010
3
7mer
333-351
0.006
2
7mer
4684-4689
0.004
4
6mer
4318-4322
0.003
2
7mer
8048-8064
0.003
2
7mer
5750-5768
0.002
2
6mer
5465-5480
0.002
2
6mer
3395-3421
0.001
2
RP11-35J1.1
hsa-miR-34b-3p
0.772

Gene Details
Chromosome: 6
Transcript: ENST00000455554
Biotype: lincRNA
Gene id: ENSG00000236635
Gene Name: RP11-35J1.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
156-171
0.031
2
RP4-684O24.5
hsa-miR-34b-3p
0.772

Gene Details
Chromosome: 20
Transcript: ENST00000446562
Biotype: antisense
Gene id: ENSG00000233896
Gene Name: RP4-684O24.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1591-1596
0.017
7
6mer
1490-1517
0.009
8
6mer
1424-1439
0.004
2
CTD-2199O4.6
hsa-miR-34b-3p
0.771

Gene Details
Chromosome: 5
Transcript: ENST00000607861
Biotype: lincRNA
Gene id: ENSG00000272417
Gene Name: CTD-2199O4.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
113-138
0.031
1
FAM182A
hsa-miR-34b-3p
0.770

Gene Details
Chromosome: 20
Transcript: ENST00000376398
Biotype: lincRNA
Gene id: ENSG00000125804
Gene Name: FAM182A
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
179-203
0.023
1
6mer
764-771
0.003
Not Conserved
6mer
4719-4738
0.002
Not Conserved
6mer
4614-4638
0.002
1
RP11-111F5.3
hsa-miR-34b-3p
0.770

Gene Details
Chromosome: 9
Transcript: ENST00000448491
Biotype: lincRNA
Gene id: ENSG00000231212
Gene Name: RP11-111F5.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Breast Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
40-60
0.030
2
LINC01224
hsa-miR-34b-3p
0.770

Gene Details
Chromosome: 19
Transcript: ENST00000593573
Biotype: lincRNA
Gene id: ENSG00000269416
Gene Name: LINC01224
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
19-36
0.015
2
6mer
58-80
0.015
2
RP11-299H21.1
hsa-miR-34b-3p
0.770

Gene Details
Chromosome: 2
Transcript: ENST00000610202
Biotype: lincRNA
Gene id: ENSG00000272902
Gene Name: RP11-299H21.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2438-2461
0.024
2
6mer
1351-1376
0.003
5
6mer
1647-1657
0.003
3
RP11-482H16.1
hsa-miR-34b-3p
0.769

Gene Details
Chromosome: 2
Transcript: ENST00000607540
Biotype: processed_transcript
Gene id: ENSG00000271894
Gene Name: RP11-482H16.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
562-589
0.022
8
7mer
51-59
0.009
1
LINC01005
hsa-miR-34b-3p
0.768

Gene Details
Chromosome: 7
Transcript: ENST00000451440
Biotype: antisense
Gene id: ENSG00000228564
Gene Name: LINC01005
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
50-67
0.016
2
7mer
196-207
0.014
1
CTD-2293H3.1
hsa-miR-34b-3p
0.767

Gene Details
Chromosome: 19
Transcript: ENST00000588369
Biotype: sense_intronic
Gene id: ENSG00000267672
Gene Name: CTD-2293H3.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
758-763
0.013
4
7mer
660-682
0.009
4
7mer
849-861
0.008
Not Conserved
RBM5-AS1
hsa-miR-34b-3p
0.767

Gene Details
Chromosome: 3
Transcript: NR_045388.1
Biotype: antisense
Gene id: NR_045388.1 (gene)
Gene Name: RBM5-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1252-1276
0.015
2
6mer
998-1019
0.012
16
6mer
239-266
0.003
Not Conserved
Funded by: