Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-34b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-386B13.3
hsa-miR-34b-3p
0.968

Gene Details
Chromosome: 4
Transcript: ENST00000511746
Biotype: lincRNA
Gene id: ENSG00000250754
Gene Name: RP11-386B13.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
864-873
0.067
15
XLOC_001935
hsa-miR-34b-3p
0.968

Gene Details
Chromosome: chr2
Transcript: TCONS_00005057
Biotype: transcript isomorph
Gene id: XLOC_001935
Gene Name: XLOC_001935
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
602-608
0.046
1
7mer
464-485
0.020
1
XLOC_008495
hsa-miR-34b-3p
0.968

Gene Details
Chromosome: chr10
Transcript: TCONS_00018740
Biotype: transcript isomorph
Gene id: XLOC_008495
Gene Name: XLOC_008495
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Liver Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1020-1042
0.039
1
8mer
969-975
0.027
1
RP11-195B17.1
hsa-miR-34b-3p
0.968

Gene Details
Chromosome: 2
Transcript: ENST00000607659
Biotype: antisense
Gene id: ENSG00000272148
Gene Name: RP11-195B17.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
11-37
0.066
2
GS1-600G8.3
hsa-miR-34b-3p
0.967

Gene Details
Chromosome: X
Transcript: ENST00000431486
Biotype: antisense
Gene id: ENSG00000231216
Gene Name: GS1-600G8.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
379-397
0.020
2
8mer
73-87
0.020
2
8mer
1230-1254
0.018
2
6mer
222-242
0.005
2
6mer
1370-1388
0.003
2
AC006548.28
hsa-miR-34b-3p
0.965

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
51312-51331
0.005
Not Conserved
7mer
54389-54414
0.004
Not Conserved
7mer
4426-4443
0.004
2
7mer
70306-70319
0.003
1
7mer
44112-44133
0.003
2
7mer
22612-22626
0.002
Not Conserved
7mer
23067-23083
0.002
1
7mer
29326-29344
0.002
1
8mer+wobble
43215-43236
0.002
2
6mer
20393-20420
0.002
4
7mer
50760-50782
0.002
Not Conserved
6mer
72888-72902
0.002
2
6mer
67187-67205
0.002
1
6mer
22148-22174
0.002
3
6mer
54919-54923
0.002
2
6mer
53412-53427
0.002
Not Conserved
6mer
48811-48831
0.002
Not Conserved
6mer
44627-44631
0.002
2
6mer
55096-55118
0.002
2
6mer
27761-27776
0.002
2
6mer
76858-76873
0.002
1
6mer
66464-66468
0.002
1
6mer
37612-37635
0.002
1
6mer
55372-55385
0.002
2
6mer
78368-78390
0.001
1
6mer
29098-29102
0.001
2
6mer
78193-78197
0.001
1
6mer
14563-14576
0.001
3
6mer
72751-72759
0.001
2
6mer
39097-39115
0.001
1
6mer
29275-29297
0.001
2
6mer
51192-51196
0.001
Not Conserved
6mer
76826-76839
0.001
1
RP11-333O1.1
hsa-miR-34b-3p
0.965

Gene Details
Chromosome: 2
Transcript: ENST00000569860
Biotype: lincRNA
Gene id: ENSG00000261117
Gene Name: RP11-333O1.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
769-790
0.065
2
XLOC_008284
hsa-miR-34b-3p
0.964

Gene Details
Chromosome: chrY
Transcript: TCONS_00017654
Biotype: transcript isomorph
Gene id: XLOC_008284
Gene Name: XLOC_008284
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
77-95
0.065
1
RP11-1094M14.5
hsa-miR-34b-3p
0.962

Gene Details
Chromosome: 17
Transcript: ENST00000592908
Biotype: sense_intronic
Gene id: ENSG00000267074
Gene Name: RP11-1094M14.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
183-192
0.064
2
XLOC_002926
hsa-miR-34b-3p
0.962

Gene Details
Chromosome: chr3
Transcript: TCONS_00006316
Biotype: transcript isomorph
Gene id: XLOC_002926
Gene Name: XLOC_002926
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
837-843
0.036
6
8mer
727-747
0.028
2
PTPRD-AS1
hsa-miR-34b-3p
0.961

Gene Details
Chromosome: 9
Transcript: ENST00000430766
Biotype: lincRNA
Gene id: ENSG00000225706
Gene Name: PTPRD-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1704-1718
0.040
4
8mer
531-543
0.015
Not Conserved
6mer
259-277
0.008
5
CTA-342B11.3
hsa-miR-34b-3p
0.961

Gene Details
Chromosome: 22
Transcript: ENST00000624235
Biotype: lincRNA
Gene id: ENSG00000280370
Gene Name: CTA-342B11.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
24525-24541
0.014
1
8mer
6309-6333
0.006
2
7mer
24184-24201
0.005
1
7mer
15876-15889
0.004
1
6mer
956-982
0.004
3
7mer
16367-16392
0.003
1
7mer
20554-20567
0.003
1
7mer
9796-9809
0.003
1
6mer
3393-3414
0.002
4
7mer
10856-10876
0.002
1
6mer
5727-5738
0.002
1
6mer
2643-2656
0.002
2
6mer
10695-10708
0.002
1
6mer
18982-18991
0.002
2
6mer
20935-20957
0.002
1
6mer
14135-14159
0.001
2
6mer
21933-21946
0.001
Not Conserved
6mer
22577-22581
0.001
Not Conserved
6mer
21069-21073
0.001
1
6mer
23216-23227
0.001
Not Conserved
XLOC_006954
hsa-miR-34b-3p
0.955

Gene Details
Chromosome: chr8
Transcript: TCONS_00014884
Biotype: transcript isomorph
Gene id: XLOC_006954
Gene Name: XLOC_006954
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Lymph Node Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
290-301
0.061
1
LOC101926935
hsa-miR-34b-3p
0.954

Gene Details
Chromosome: 20
Transcript: NR_110001.1
Biotype: sense
Gene id: NR_110001.1 (gene)
Gene Name: LOC101926935
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
5864-5877
0.032
1
6mer
4755-4771
0.011
1
6mer
3125-3143
0.006
1
6mer
4694-4701
0.004
1
6mer
268-279
0.003
Not Conserved
6mer
198-209
0.002
Not Conserved
6mer
233-244
0.002
Not Conserved
MIR4534
hsa-miR-34b-3p
0.952

Gene Details
Chromosome: 22
Transcript: ENST00000623111
Biotype: sense_overlapping
Gene id: ENSG00000279010
Gene Name: MIR4534
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
10897-10920
0.006
1
6mer
37756-37769
0.005
8
6mer
20738-20760
0.004
10
7mer
30518-30531
0.004
2
7mer
1847-1867
0.004
2
7mer
11545-11558
0.004
2
7mer
14729-14741
0.003
2
7mer
5309-5317
0.003
5
7mer
7831-7844
0.003
1
7mer
12920-12945
0.003
1
7mer
21154-21159
0.003
2
8mer
11118-11135
0.002
2
6mer
33915-33928
0.002
1
6mer
16891-16896
0.002
2
7mer
28836-28861
0.001
2
6mer
31116-31130
0.001
2
6mer
36979-37002
0.001
1
6mer
43003-43008
0.001
1
6mer
44274-44288
0.001
1
6mer
1566-1592
0.001
1
6mer
16447-16462
0.001
Not Conserved
6mer
47270-47285
0.001
Not Conserved
6mer
16277-16297
0.001
1
6mer
32460-32475
0.001
1
6mer
16918-16928
0.001
2
XLOC_007688
hsa-miR-34b-3p
0.952

Gene Details
Chromosome: chr9
Transcript: TCONS_00015809
Biotype: transcript isomorph
Gene id: XLOC_007688
Gene Name: XLOC_007688
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Lung Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
9-34
0.060
2
XLOC_009815
hsa-miR-34b-3p
0.947

Gene Details
Chromosome: chr12
Transcript: TCONS_00020490
Biotype: transcript isomorph
Gene id: XLOC_009815
Gene Name: XLOC_009815
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
189-215
0.047
10
6mer
180-189
0.011
8
NPHP3-ACAD11
hsa-miR-34b-3p
0.946

Gene Details
Chromosome: 3
Transcript: NR_037804.1
Biotype: sense
Gene id: NR_037804.1 (gene)
Gene Name: NPHP3-ACAD11
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2524-2551
0.035
8
6mer
60-68
0.005
2
7mer
1796-1817
0.004
2
6mer
6449-6465
0.003
8
6mer
3555-3580
0.003
5
6mer
2079-2099
0.002
4
6mer
1557-1568
0.002
Not Conserved
6mer
2431-2451
0.002
9
6mer
5130-5157
0.002
4
XLOC_012784
hsa-miR-34b-3p
0.946

Gene Details
Chromosome: chr18
Transcript: TCONS_00026436
Biotype: transcript isomorph
Gene id: XLOC_012784
Gene Name: XLOC_012784
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HREpiC Kidney Normal/Primary
- Lymph Node Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1080-1099
0.045
1
6mer
1888-1914
0.013
1
RP11-445O3.3
hsa-miR-34b-3p
0.943

Gene Details
Chromosome: 5
Transcript: ENST00000562127
Biotype: lincRNA
Gene id: ENSG00000260763
Gene Name: RP11-445O3.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1101-1125
0.027
1
6mer
225-244
0.025
1
6mer
1812-1826
0.005
1
Funded by: