Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-34b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
LINC00665
hsa-miR-34b-3p
0.942

Gene Details
Chromosome: 19
Transcript: ENST00000590657
Biotype: lincRNA
Gene id: ENSG00000232677
Gene Name: LINC00665
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
590-604
0.028
2
7mer
771-789
0.021
2
6mer
1969-1993
0.007
1
LLNLR-470E3.1
hsa-miR-34b-3p
0.940

Gene Details
Chromosome: 19
Transcript: ENST00000619715
Biotype: sense_intronic
Gene id: ENSG00000273837
Gene Name: LLNLR-470E3.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
220-237
0.056
2
RP11-96K19.4
hsa-miR-34b-3p
0.938

Gene Details
Chromosome: 1
Transcript: ENST00000562952
Biotype: sense_overlapping
Gene id: ENSG00000261654
Gene Name: RP11-96K19.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
5746-5759
0.030
2
7mer
5657-5665
0.025
2
CTC-459F4.3
hsa-miR-34b-3p
0.937

Gene Details
Chromosome: 19
Transcript: ENST00000621046
Biotype: sense_intronic
Gene id: ENSG00000267575
Gene Name: CTC-459F4.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
492-519
0.019
1
6mer
487-508
0.019
1
6mer
346-372
0.017
1
PCAT14
hsa-miR-34b-3p
0.936

Gene Details
Chromosome: 22
Transcript: NR_109832.1
Biotype: lincRNA
Gene id: NR_109832.1 (gene)
Gene Name: PCAT14
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1058-1077
0.038
1
6mer
980-1005
0.017
1
XLOC_003897
hsa-miR-34b-3p
0.935

Gene Details
Chromosome: chr4
Transcript: TCONS_00007417
Biotype: transcript isomorph
Gene id: XLOC_003897
Gene Name: XLOC_003897
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
913-938
0.026
7
6mer
1222-1226
0.013
11
6mer
154-161
0.005
2
6mer
499-520
0.005
2
6mer
705-709
0.004
2
RP11-576E20.1
hsa-miR-34b-3p
0.934

Gene Details
Chromosome: 4
Transcript: ENST00000509964
Biotype: lincRNA
Gene id: ENSG00000250819
Gene Name: RP11-576E20.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
914-939
0.026
7
6mer
1223-1227
0.013
11
6mer
155-162
0.005
2
6mer
500-521
0.005
2
6mer
706-710
0.004
2
CTD-2561J22.5
hsa-miR-34b-3p
0.933

Gene Details
Chromosome: 19
Transcript: ENST00000599993
Biotype: lincRNA
Gene id: ENSG00000268119
Gene Name: CTD-2561J22.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
360-378
0.022
2
6mer
889-902
0.019
2
7mer
522-535
0.013
1
TSIX
hsa-miR-34b-3p
0.931

Gene Details
Chromosome: X
Transcript: ENST00000604411
Biotype: lincRNA
Gene id: ENSG00000270641
Gene Name: TSIX
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
29490-29500
0.009
7
7mer
11593-11614
0.004
Not Conserved
7mer
7784-7803
0.004
1
7mer
16433-16453
0.003
1
7mer
31024-31040
0.003
2
7mer
13457-13482
0.003
Not Conserved
6mer
28018-28028
0.003
3
6mer
32618-32633
0.002
3
6mer
19888-19892
0.002
1
6mer
33582-33586
0.002
3
6mer
17116-17120
0.002
2
6mer
15947-15971
0.002
Not Conserved
6mer
9551-9555
0.002
2
6mer
34259-34273
0.002
2
6mer
19621-19638
0.002
2
6mer
18171-18175
0.002
1
7mer
10138-10164
0.002
Not Conserved
6mer
3682-3696
0.001
1
6mer
9834-9858
0.001
1
6mer
9988-10011
0.001
1
6mer
15128-15132
0.001
Not Conserved
6mer
11292-11302
0.001
Not Conserved
XLOC_000280
hsa-miR-34b-3p
0.931

Gene Details
Chromosome: chr1
Transcript: TCONS_00001014
Biotype: transcript isomorph
Gene id: XLOC_000280
Gene Name: XLOC_000280
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
199-212
0.053
10
AP000233.4
hsa-miR-34b-3p
0.928

Gene Details
Chromosome: 21
Transcript: ENST00000409758
Biotype: lincRNA
Gene id: ENSG00000222042
Gene Name: AP000233.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
711-726
0.026
2
7mer
283-303
0.016
1
7mer
316-334
0.011
1
CTD-2561J22.5
hsa-miR-34b-3p
0.927

Gene Details
Chromosome: 19
Transcript: ENST00000597444
Biotype: lincRNA
Gene id: ENSG00000268119
Gene Name: CTD-2561J22.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
255-273
0.020
2
6mer
784-797
0.019
2
7mer
417-430
0.013
1
RP11-393J16.4
hsa-miR-34b-3p
0.926

Gene Details
Chromosome: 10
Transcript: ENST00000412789
Biotype: lincRNA
Gene id: ENSG00000226447
Gene Name: RP11-393J16.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
66-86
0.052
2
RP11-374A4.1
hsa-miR-34b-3p
0.925

Gene Details
Chromosome: 5
Transcript: ENST00000503488
Biotype: lincRNA
Gene id: ENSG00000249359
Gene Name: RP11-374A4.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Heart Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
6-33
0.018
3
7mer
832-845
0.014
2
7mer
2535-2552
0.007
7
7mer
1185-1204
0.006
2
7mer
3432-3437
0.005
Not Conserved
6mer
1490-1505
0.002
2
LINC01189
hsa-miR-34b-3p
0.923

Gene Details
Chromosome: 9
Transcript: ENST00000428440
Biotype: lincRNA
Gene id: ENSG00000232827
Gene Name: LINC01189
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
71-78
0.038
2
6mer
2892-2905
0.007
1
6mer
2929-2953
0.006
1
CTD-2561J22.5
hsa-miR-34b-3p
0.922

Gene Details
Chromosome: 19
Transcript: ENST00000594557
Biotype: retained_intron
Gene id: ENSG00000268119
Gene Name: CTD-2561J22.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
740-746
0.020
1
6mer
4638-4651
0.010
2
7mer
1158-1171
0.006
1
6mer
2654-2664
0.005
2
7mer
1678-1691
0.004
1
6mer
1516-1534
0.004
2
6mer
960-984
0.003
1
LINC00665
hsa-miR-34b-3p
0.920

Gene Details
Chromosome: 19
Transcript: ENST00000585356
Biotype: lincRNA
Gene id: ENSG00000232677
Gene Name: LINC00665
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
590-604
0.028
2
7mer
771-789
0.022
2
RP11-89K21.1
hsa-miR-34b-3p
0.917

Gene Details
Chromosome: 2
Transcript: ENST00000430847
Biotype: lincRNA
Gene id: ENSG00000259439
Gene Name: RP11-89K21.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Kidney Normal/Primary
A549 Lung Cancer/Malignant
- Prostate Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
122-127
0.037
10
6mer
25-48
0.013
12
RP11-21B23.2
hsa-miR-34b-3p
0.914

Gene Details
Chromosome: 16
Transcript: ENST00000566876
Biotype: lincRNA
Gene id: ENSG00000261092
Gene Name: RP11-21B23.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
10-16
0.045
12
6mer
323-338
0.004
1
XLOC_002730
hsa-miR-34b-3p
0.912

Gene Details
Chromosome: chr3
Transcript: TCONS_00006916
Biotype: transcript isomorph
Gene id: XLOC_002730
Gene Name: XLOC_002730
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HREpiC Kidney Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
110-121
0.049
4
Funded by: