Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-34b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
CTD-2291D10.3
hsa-miR-34b-3p
0.911

Gene Details
Chromosome: 19
Transcript: ENST00000599269
Biotype: lincRNA
Gene id: ENSG00000269543
Gene Name: CTD-2291D10.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
77-93
0.025
1
6mer
187-198
0.024
1
LINC00293
hsa-miR-34b-3p
0.907

Gene Details
Chromosome: 8
Transcript: NR_027012.1
Biotype: lincRNA
Gene id: NR_027012.1 (gene)
Gene Name: LINC00293
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
2127-2146
0.026
2
7mer
1264-1278
0.022
2
XLOC_009511
hsa-miR-34b-3p
0.906

Gene Details
Chromosome: chr11
Transcript: TCONS_00020103
Biotype: transcript isomorph
Gene id: XLOC_009511
Gene Name: XLOC_009511
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Ovary Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
889-899
0.048
1
KCNQ1OT1
hsa-miR-34b-3p
0.906

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
67205-67216
0.004
5
7mer
84802-84828
0.004
1
7mer
15378-15397
0.003
Not Conserved
7mer
19487-19501
0.003
2
7mer
30645-30667
0.003
Not Conserved
6mer
69381-69398
0.003
4
7mer
9767-9783
0.003
2
7mer
54675-54698
0.002
2
7mer
5639-5653
0.002
2
6mer
46243-46247
0.002
2
6mer
46693-46706
0.002
2
6mer
27786-27800
0.002
1
6mer
84066-84081
0.002
2
6mer
89245-89258
0.002
2
6mer
18937-18959
0.002
2
6mer
72494-72499
0.002
1
6mer
73961-73981
0.002
1
6mer
83473-83491
0.001
2
6mer
16334-16358
0.001
1
6mer
31951-31971
0.001
1
6mer
59043-59062
0.001
2
6mer
83464-83491
0.000
2
RP11-1109M24.5
hsa-miR-34b-3p
0.905

Gene Details
Chromosome: 17
Transcript: ENST00000578881
Biotype: lincRNA
Gene id: ENSG00000264956
Gene Name: RP11-1109M24.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1222-1231
0.035
1
7mer
320-331
0.013
1
CTD-2269F5.1
hsa-miR-34b-3p
0.905

Gene Details
Chromosome: 5
Transcript: ENST00000502253
Biotype: antisense
Gene id: ENSG00000250320
Gene Name: CTD-2269F5.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
201-215
0.043
4
6mer
268-280
0.005
4
CASC15
hsa-miR-34b-3p
0.905

Gene Details
Chromosome: 6
Transcript: ENST00000605917
Biotype: lincRNA
Gene id: ENSG00000272168
Gene Name: CASC15
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3891-3899
0.015
3
7mer
4135-4140
0.012
4
6mer
211-226
0.007
8
7mer
2647-2672
0.005
9
8mer
1239-1259
0.005
2
6mer
689-710
0.004
4
XLOC_006057
hsa-miR-34b-3p
0.904

Gene Details
Chromosome: chr7
Transcript: TCONS_00013422
Biotype: transcript isomorph
Gene id: XLOC_006057
Gene Name: XLOC_006057
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
A549 Lung Cancer/Malignant
Fibroblasts Lung Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
34-45
0.047
2
CTC-340A15.2
hsa-miR-34b-3p
0.902

Gene Details
Chromosome: 5
Transcript: ENST00000524297
Biotype: antisense
Gene id: ENSG00000241956
Gene Name: CTC-340A15.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
- Testes Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
867-881
0.032
1
7mer
34-53
0.015
5
RP11-562L8.1
hsa-miR-34b-3p
0.902

Gene Details
Chromosome: 14
Transcript: ENST00000548665
Biotype: lincRNA
Gene id: ENSG00000257522
Gene Name: RP11-562L8.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
473-478
0.044
10
6mer
247-261
0.003
2
CTA-929C8.9
hsa-miR-34b-3p
0.901

Gene Details
Chromosome: 22
Transcript: ENST00000624278
Biotype: sense_intronic
Gene id: ENSG00000279185
Gene Name: CTA-929C8.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
8439-8458
0.012
1
8mer
20986-21009
0.008
1
6mer
5335-5342
0.003
5
7mer
16986-17010
0.003
1
6mer
12577-12603
0.002
2
6mer
5146-5166
0.002
5
6mer
12110-12114
0.002
2
6mer
14587-14606
0.002
Not Conserved
6mer
10392-10407
0.002
2
6mer
10065-10087
0.002
1
6mer
2635-2652
0.002
1
6mer
17168-17172
0.002
2
6mer
15528-15541
0.002
1
6mer
8185-8196
0.001
2
6mer
19672-19686
0.001
1
6mer
21113-21120
0.001
1
LINC00845
hsa-miR-34b-3p
0.900

Gene Details
Chromosome: 10
Transcript: ENST00000417931
Biotype: lincRNA
Gene id: ENSG00000227244
Gene Name: LINC00845
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
597-610
0.047
3
LINC00845
hsa-miR-34b-3p
0.900

Gene Details
Chromosome: 10
Transcript: NR_108052.1
Biotype: lincRNA
Gene id: NR_108052.1 (gene)
Gene Name: LINC00845
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
597-610
0.047
3
FTX
hsa-miR-34b-3p
0.898

Gene Details
Chromosome: X
Transcript: ENST00000602576
Biotype: lincRNA
Gene id: ENSG00000230590
Gene Name: FTX
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
74-97
0.028
1
7mer
91-109
0.018
3
XLOC_012819
hsa-miR-34b-3p
0.897

Gene Details
Chromosome: chr18
Transcript: TCONS_00026493
Biotype: transcript isomorph
Gene id: XLOC_012819
Gene Name: XLOC_012819
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
213-234
0.026
1
6mer
108-121
0.020
10
LINC00614
hsa-miR-34b-3p
0.897

Gene Details
Chromosome: 10
Transcript: ENST00000433966
Biotype: lincRNA
Gene id: ENSG00000236983
Gene Name: LINC00614
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
114-127
0.046
2
RP11-1112C15.2
hsa-miR-34b-3p
0.892

Gene Details
Chromosome: 8
Transcript: ENST00000518750
Biotype: lincRNA
Gene id: ENSG00000253523
Gene Name: RP11-1112C15.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
222-242
0.034
3
7mer
444-449
0.012
1
RP11-15H20.6
hsa-miR-34b-3p
0.891

Gene Details
Chromosome: 19
Transcript: ENST00000601239
Biotype: retained_intron
Gene id: ENSG00000213971
Gene Name: RP11-15H20.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
27-48
0.022
2
6mer
886-911
0.010
2
6mer
283-287
0.009
1
6mer
820-838
0.003
1
MIR29B1
hsa-miR-34b-3p
0.891

Gene Details
Chromosome: 7
Transcript: ENST00000432045
Biotype: lincRNA
Gene id: ENSG00000226380
Gene Name: MIR29B1
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
685-711
0.037
10
7mer
3385-3398
0.004
2
7mer
2617-2632
0.003
3
6mer
2480-2484
0.001
3
XLOC_001223
hsa-miR-34b-3p
0.890

Gene Details
Chromosome: chr1
Transcript: TCONS_00001838
Biotype: transcript isomorph
Gene id: XLOC_001223
Gene Name: XLOC_001223
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1071-1082
0.045
2
Funded by: