Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-34b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-586K12.10
hsa-miR-34b-3p
0.889

Gene Details
Chromosome: 16
Transcript: ENST00000570183
Biotype: lincRNA
Gene id: ENSG00000260311
Gene Name: RP11-586K12.10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1798-1821
0.022
1
6mer
1994-1998
0.016
1
7mer
82-109
0.007
Not Conserved
DLEU2
hsa-miR-34b-3p
0.888

Gene Details
Chromosome: 13
Transcript: ENST00000621282
Biotype: antisense
Gene id: ENSG00000231607
Gene Name: DLEU2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
161-168
0.017
1
8mer
146-160
0.013
1
6mer
2775-2800
0.009
9
7mer
566-579
0.006
1
LINC00240
hsa-miR-34b-3p
0.886

Gene Details
Chromosome: 6
Transcript: ENST00000607607
Biotype: lincRNA
Gene id: ENSG00000224843
Gene Name: LINC00240
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
5575-5602
0.017
2
7mer
4647-4660
0.012
2
7mer
2907-2924
0.008
6
7mer
4288-4307
0.006
2
6mer
3947-3966
0.002
2
XLOC_012700
hsa-miR-34b-3p
0.886

Gene Details
Chromosome: chr18
Transcript: TCONS_00026348
Biotype: transcript isomorph
Gene id: XLOC_012700
Gene Name: XLOC_012700
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Breast Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
66-88
0.044
2
DLEU2
hsa-miR-34b-3p
0.884

Gene Details
Chromosome: 13
Transcript: NR_002612.1
Biotype: antisense
Gene id: NR_002612.1 (gene)
Gene Name: DLEU2
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
161-168
0.017
1
8mer
146-160
0.013
1
6mer
2475-2500
0.008
9
7mer
566-579
0.006
1
AC079466.1
hsa-miR-34b-3p
0.884

Gene Details
Chromosome: 19
Transcript: ENST00000587961
Biotype: lincRNA
Gene id: ENSG00000266976
Gene Name: AC079466.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
171-184
0.026
2
6mer
4112-4121
0.017
2
AGAP11
hsa-miR-34b-3p
0.883

Gene Details
Chromosome: 10
Transcript: ENST00000444431
Biotype: processed_transcript
Gene id: ENSG00000151303
Gene Name: AGAP11
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
469-491
0.036
1
6mer
286-311
0.005
1
6mer
3084-3089
0.003
2
LINC00664
hsa-miR-34b-3p
0.883

Gene Details
Chromosome: 19
Transcript: ENST00000596203
Biotype: lincRNA
Gene id: ENSG00000268658
Gene Name: LINC00664
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
69-95
0.025
2
7mer
432-455
0.019
2
RP11-1086F11.1
hsa-miR-34b-3p
0.882

Gene Details
Chromosome: 1
Transcript: ENST00000417786
Biotype: sense_intronic
Gene id: ENSG00000225300
Gene Name: RP11-1086F11.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
689-706
0.044
1
XLOC_003662
hsa-miR-34b-3p
0.881

Gene Details
Chromosome: chr4
Transcript: TCONS_00008207
Biotype: transcript isomorph
Gene id: XLOC_003662
Gene Name: XLOC_003662
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
56-67
0.043
2
XLOC_001564
hsa-miR-34b-3p
0.880

Gene Details
Chromosome: chr2
Transcript: TCONS_00003762
Biotype: transcript isomorph
Gene id: XLOC_001564
Gene Name: XLOC_001564
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
824-843
0.014
1
6mer
993-997
0.013
2
6mer
882-909
0.012
2
6mer
677-702
0.004
1
CTA-796E4.5
hsa-miR-34b-3p
0.878

Gene Details
Chromosome: 22
Transcript: ENST00000624243
Biotype: lincRNA
Gene id: ENSG00000280065
Gene Name: CTA-796E4.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
12057-12062
0.008
2
9mer
14770-14778
0.006
1
6mer
621-638
0.005
6
8mer
6127-6146
0.005
3
7mer
30734-30752
0.004
Not Conserved
6mer
29941-29965
0.003
6
7mer
2054-2080
0.003
2
6mer
25171-25195
0.002
1
6mer
9833-9840
0.002
2
6mer
7289-7302
0.002
1
6mer
17140-17167
0.001
2
6mer
19410-19428
0.001
1
6mer
21094-21113
0.001
2
XLOC_008274
hsa-miR-34b-3p
0.878

Gene Details
Chromosome: chrY
Transcript: TCONS_00017605
Biotype: transcript isomorph
Gene id: XLOC_008274
Gene Name: XLOC_008274
UCSC graphic: -
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1655-1672
0.017
2
7mer
1322-1327
0.009
2
6mer
5282-5296
0.007
2
6mer
3950-3954
0.003
2
6mer
4165-4184
0.003
1
6mer
3565-3569
0.002
1
7mer
2541-2559
0.001
Not Conserved
RP11-96B2.1
hsa-miR-34b-3p
0.877

Gene Details
Chromosome: 8
Transcript: ENST00000530350
Biotype: lincRNA
Gene id: ENSG00000255325
Gene Name: RP11-96B2.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
69-92
0.043
2
RP11-171L9.1
hsa-miR-34b-3p
0.875

Gene Details
Chromosome: 12
Transcript: ENST00000546865
Biotype: lincRNA
Gene id: ENSG00000257165
Gene Name: RP11-171L9.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
389-414
0.035
1
6mer
471-498
0.005
3
6mer
311-331
0.002
1
RP11-522B15.3
hsa-miR-34b-3p
0.875

Gene Details
Chromosome: 15
Transcript: ENST00000558499
Biotype: lincRNA
Gene id: ENSG00000259275
Gene Name: RP11-522B15.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2394-2417
0.016
2
8mer
3931-3937
0.014
9
6mer
3846-3860
0.007
11
6mer
1348-1352
0.003
3
6mer
945-969
0.003
4
RP11-34P13.13
hsa-miR-34b-3p
0.873

Gene Details
Chromosome: 1
Transcript: ENST00000484859
Biotype: antisense
Gene id: ENSG00000241860
Gene Name: RP11-34P13.13
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2972-2983
0.014
2
7mer
2510-2523
0.013
2
6mer
407-434
0.008
1
6mer
2374-2388
0.004
2
6mer
1857-1881
0.003
1
CTD-2529P6.4
hsa-miR-34b-3p
0.872

Gene Details
Chromosome: 19
Transcript: ENST00000595277
Biotype: sense_intronic
Gene id: ENSG00000269400
Gene Name: CTD-2529P6.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
222-237
0.042
2
RP11-1437A8.4
hsa-miR-34b-3p
0.872

Gene Details
Chromosome: 16
Transcript: ENST00000563960
Biotype: lincRNA
Gene id: ENSG00000260827
Gene Name: RP11-1437A8.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
666-689
0.020
1
6mer
489-493
0.015
1
7mer
2378-2405
0.007
Not Conserved
RP11-131K5.2
hsa-miR-34b-3p
0.871

Gene Details
Chromosome: 17
Transcript: ENST00000580134
Biotype: lincRNA
Gene id: ENSG00000265494
Gene Name: RP11-131K5.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
1906-1921
0.029
2
6mer
1600-1625
0.013
2
Funded by: