Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-34b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-555K2.4
hsa-miR-34b-3p
0.869

Gene Details
Chromosome: 21
Transcript: ENST00000624226
Biotype: lincRNA
Gene id: ENSG00000279321
Gene Name: RP11-555K2.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
436-456
0.026
2
6mer
546-572
0.016
2
CTD-3220F14.2
hsa-miR-34b-3p
0.868

Gene Details
Chromosome: 19
Transcript: ENST00000592319
Biotype: sense_intronic
Gene id: ENSG00000267682
Gene Name: CTD-3220F14.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
172-194
0.041
1
XLOC_009783
hsa-miR-34b-3p
0.868

Gene Details
Chromosome: chr12
Transcript: TCONS_00020451
Biotype: transcript isomorph
Gene id: XLOC_009783
Gene Name: XLOC_009783
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1384-1389
0.026
1
6mer
250-254
0.015
1
CTC-260E6.6
hsa-miR-34b-3p
0.866

Gene Details
Chromosome: 19
Transcript: ENST00000585816
Biotype: antisense
Gene id: ENSG00000267383
Gene Name: CTC-260E6.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
238-259
0.033
1
6mer
121-125
0.008
1
RP11-206L10.3
hsa-miR-34b-3p
0.865

Gene Details
Chromosome: 1
Transcript: ENST00000416385
Biotype: lincRNA
Gene id: ENSG00000235373
Gene Name: RP11-206L10.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2972-2983
0.014
1
7mer
2507-2520
0.013
1
6mer
1857-1881
0.007
1
6mer
2371-2385
0.004
1
6mer
407-434
0.003
Not Conserved
KB-1592A4.15
hsa-miR-34b-3p
0.862

Gene Details
Chromosome: 22
Transcript: ENST00000420508
Biotype: lincRNA
Gene id: ENSG00000197210
Gene Name: KB-1592A4.15
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
228-250
0.022
1
7mer
273-282
0.015
1
6mer
184-199
0.003
1
RP11-523H20.3
hsa-miR-34b-3p
0.861

Gene Details
Chromosome: 2
Transcript: ENST00000606287
Biotype: antisense
Gene id: ENSG00000272183
Gene Name: RP11-523H20.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
85-102
0.037
7
6mer
357-371
0.004
1
RP11-594N15.2
hsa-miR-34b-3p
0.859

Gene Details
Chromosome: 8
Transcript: ENST00000522302
Biotype: lincRNA
Gene id: ENSG00000254266
Gene Name: RP11-594N15.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1692-1706
0.018
1
7mer
1749-1768
0.012
2
7mer
1643-1664
0.005
2
6mer
901-921
0.005
4
RP11-386B13.3
hsa-miR-34b-3p
0.859

Gene Details
Chromosome: 4
Transcript: ENST00000509017
Biotype: lincRNA
Gene id: ENSG00000250754
Gene Name: RP11-386B13.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1012-1021
0.040
15
CTC-444N24.11
hsa-miR-34b-3p
0.859

Gene Details
Chromosome: 19
Transcript: ENST00000593427
Biotype: lincRNA
Gene id: ENSG00000268205
Gene Name: CTC-444N24.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4148-4169
0.019
2
9mer
1105-1127
0.017
2
6mer
2756-2760
0.003
2
XLOC_013010
hsa-miR-34b-3p
0.858

Gene Details
Chromosome: chr19
Transcript: TCONS_00026952
Biotype: transcript isomorph
Gene id: XLOC_013010
Gene Name: XLOC_013010
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1327-1338
0.020
1
6mer
357-369
0.016
1
6mer
1477-1497
0.003
Not Conserved
RP11-968A15.2
hsa-miR-34b-3p
0.858

Gene Details
Chromosome: 12
Transcript: ENST00000547177
Biotype: antisense
Gene id: ENSG00000257596
Gene Name: RP11-968A15.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
216-235
0.033
7
6mer
623-648
0.007
2
AC016723.4
hsa-miR-34b-3p
0.857

Gene Details
Chromosome: 2
Transcript: ENST00000436982
Biotype: antisense
Gene id: ENSG00000235335
Gene Name: AC016723.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
471-488
0.040
11
RP11-679C8.2
hsa-miR-34b-3p
0.857

Gene Details
Chromosome: 4
Transcript: ENST00000503073
Biotype: antisense
Gene id: ENSG00000250938
Gene Name: RP11-679C8.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2211-2225
0.031
2
7mer
755-768
0.009
5
LINC00238
hsa-miR-34b-3p
0.856

Gene Details
Chromosome: 14
Transcript: ENST00000450299
Biotype: lincRNA
Gene id: ENSG00000196553
Gene Name: LINC00238
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
443-456
0.040
7
XLOC_012690
hsa-miR-34b-3p
0.855

Gene Details
Chromosome: chr18
Transcript: TCONS_00026340
Biotype: transcript isomorph
Gene id: XLOC_012690
Gene Name: XLOC_012690
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Lung Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
1471-1475
0.020
10
6mer
1440-1466
0.018
9
6mer
815-837
0.002
1
FLJ10038
hsa-miR-34b-3p
0.854

Gene Details
Chromosome: 15
Transcript: NR_026891.1
Biotype: sense
Gene id: NR_026891.1 (gene)
Gene Name: FLJ10038
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
952-972
0.009
1
8mer
1175-1181
0.009
4
7mer
4219-4224
0.008
2
6mer
5066-5070
0.006
7
6mer
572-598
0.004
2
6mer
487-491
0.003
2
RP11-348N5.9
hsa-miR-34b-3p
0.854

Gene Details
Chromosome: 10
Transcript: ENST00000619110
Biotype: antisense
Gene id: ENSG00000278601
Gene Name: RP11-348N5.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
166-188
0.020
Not Conserved
7mer
257-276
0.014
1
6mer
471-481
0.005
1
RP11-111F5.3
hsa-miR-34b-3p
0.852

Gene Details
Chromosome: 9
Transcript: ENST00000438072
Biotype: lincRNA
Gene id: ENSG00000231212
Gene Name: RP11-111F5.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Breast Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
242-262
0.025
2
6mer
126-152
0.015
2
XLOC_000329
hsa-miR-34b-3p
0.852

Gene Details
Chromosome: chr1
Transcript: TCONS_00001086
Biotype: transcript isomorph
Gene id: XLOC_000329
Gene Name: XLOC_000329
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
830-834
0.019
10
6mer
803-830
0.017
9
6mer
490-513
0.003
2
Funded by: