Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-34b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-50I19.2
hsa-miR-34b-3p
0.852

Gene Details
Chromosome: 12
Transcript: ENST00000616998
Biotype: lincRNA
Gene id: ENSG00000276136
Gene Name: RP11-50I19.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
325-331
0.023
2
6mer
811-815
0.009
2
6mer
830-847
0.007
2
XLOC_014393
hsa-miR-34b-3p
0.851

Gene Details
Chromosome: chr22
Transcript: TCONS_00029709
Biotype: transcript isomorph
Gene id: XLOC_014393
Gene Name: XLOC_014393
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
363-390
0.039
2
TUG1
hsa-miR-34b-3p
0.851

Gene Details
Chromosome: 22
Transcript: ENST00000540687
Biotype: antisense
Gene id: ENSG00000253352
Gene Name: TUG1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
226-242
0.017
4
7mer
2304-2322
0.012
7
6mer
1101-1120
0.005
7
6mer
1557-1561
0.005
6
MALAT1
hsa-miR-34b-3p
0.851

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
6704-6719
0.019
8
6mer
8558-8573
0.005
2
7mer
6784-6801
0.004
8
7mer
6199-6223
0.004
1
6mer
4514-4533
0.003
7
6mer
1685-1706
0.003
3
6mer
1751-1756
0.001
1
XLOC_006126
hsa-miR-34b-3p
0.850

Gene Details
Chromosome: chr7
Transcript: TCONS_00013478
Biotype: transcript isomorph
Gene id: XLOC_006126
Gene Name: XLOC_006126
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
688-699
0.027
1
8mer
718-733
0.012
Not Conserved
XLOC_002317
hsa-miR-34b-3p
0.850

Gene Details
Chromosome: chr2
Transcript: TCONS_00004443
Biotype: transcript isomorph
Gene id: XLOC_002317
Gene Name: XLOC_002317
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
670-692
0.021
2
7mer
3397-3409
0.007
1
6mer
795-818
0.005
2
6mer
1190-1204
0.004
2
6mer
2096-2114
0.002
2
RP11-353M9.1
hsa-miR-34b-3p
0.850

Gene Details
Chromosome: 10
Transcript: ENST00000449462
Biotype: antisense
Gene id: ENSG00000234091
Gene Name: RP11-353M9.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
344-368
0.039
5
RP11-363G2.4
hsa-miR-34b-3p
0.850

Gene Details
Chromosome: 13
Transcript: ENST00000445646
Biotype: lincRNA
Gene id: ENSG00000229556
Gene Name: RP11-363G2.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
660-670
0.014
1
6mer
1744-1752
0.014
1
7mer
794-799
0.011
1
RP11-359K18.3
hsa-miR-34b-3p
0.849

Gene Details
Chromosome: 1
Transcript: ENST00000563991
Biotype: antisense
Gene id: ENSG00000259788
Gene Name: RP11-359K18.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
126-145
0.020
2
9mer
145-157
0.019
2
XLOC_002779
hsa-miR-34b-3p
0.849

Gene Details
Chromosome: chr3
Transcript: TCONS_00006171
Biotype: transcript isomorph
Gene id: XLOC_002779
Gene Name: XLOC_002779
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
59-85
0.019
8
7mer
22-44
0.005
1
6mer
836-856
0.005
3
6mer
3487-3508
0.004
3
6mer
3854-3878
0.004
Not Conserved
7mer
3244-3259
0.002
2
XLOC_003341
hsa-miR-34b-3p
0.848

Gene Details
Chromosome: chr3
Transcript: TCONS_00006715
Biotype: transcript isomorph
Gene id: XLOC_003341
Gene Name: XLOC_003341
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
16-29
0.039
2
RP11-70D24.3
hsa-miR-34b-3p
0.847

Gene Details
Chromosome: 16
Transcript: ENST00000617603
Biotype: lincRNA
Gene id: ENSG00000277214
Gene Name: RP11-70D24.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
318-325
0.039
6
FAM13A-AS1
hsa-miR-34b-3p
0.846

Gene Details
Chromosome: 4
Transcript: ENST00000511543
Biotype: antisense
Gene id: ENSG00000248019
Gene Name: FAM13A-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1970-1993
0.035
5
6mer
232-253
0.003
3
MIR6818
hsa-miR-34b-3p
0.846

Gene Details
Chromosome: 22
Transcript: ENST00000624945
Biotype: antisense
Gene id: ENSG00000279159
Gene Name: MIR6818
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
9378-9392
0.005
6
7mer
38618-38644
0.005
3
7mer
43939-43955
0.005
2
7mer
2784-2797
0.004
1
7mer
19606-19619
0.003
1
6mer
47909-47926
0.003
5
6mer
12820-12824
0.002
3
6mer
17509-17520
0.002
2
6mer
33351-33355
0.002
2
6mer
38445-38471
0.002
2
6mer
24610-24621
0.002
1
6mer
34869-34895
0.002
3
6mer
47831-47847
0.001
7
6mer
35274-35295
0.001
2
RP11-88L24.4
hsa-miR-34b-3p
0.845

Gene Details
Chromosome: 2
Transcript: ENST00000582038
Biotype: antisense
Gene id: ENSG00000266413
Gene Name: RP11-88L24.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
578-602
0.038
2
DLGAP1-AS2
hsa-miR-34b-3p
0.845

Gene Details
Chromosome: 18
Transcript: ENST00000572856
Biotype: antisense
Gene id: ENSG00000262001
Gene Name: DLGAP1-AS2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
317-339
0.028
4
7mer
989-995
0.004
2
6mer
608-627
0.004
4
6mer
1168-1188
0.003
2
RP11-3B12.2
hsa-miR-34b-3p
0.844

Gene Details
Chromosome: 7
Transcript: ENST00000424515
Biotype: lincRNA
Gene id: ENSG00000237764
Gene Name: RP11-3B12.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1194-1199
0.030
7
7mer
405-430
0.008
1
GS1-358P8.4
hsa-miR-34b-3p
0.844

Gene Details
Chromosome: X
Transcript: ENST00000568479
Biotype: sense_overlapping
Gene id: ENSG00000260822
Gene Name: GS1-358P8.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
491-506
0.021
2
6mer
4935-4948
0.011
6
6mer
3792-3805
0.002
2
6mer
4067-4091
0.002
Not Conserved
6mer
3814-3835
0.002
3
AP000855.4
hsa-miR-34b-3p
0.841

Gene Details
Chromosome: 21
Transcript: ENST00000433210
Biotype: lincRNA
Gene id: ENSG00000231620
Gene Name: AP000855.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
506-517
0.038
3
XLOC_002258
hsa-miR-34b-3p
0.839

Gene Details
Chromosome: chr2
Transcript: TCONS_00004374
Biotype: transcript isomorph
Gene id: XLOC_002258
Gene Name: XLOC_002258
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Breast Normal/Primary
- Kidney Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2049-2063
0.018
1
6mer
2250-2272
0.014
2
6mer
898-921
0.005
1
Funded by: