Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-34b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-378I13.1
hsa-miR-34b-3p
0.839

Gene Details
Chromosome: 1
Transcript: ENST00000425435
Biotype: antisense
Gene id: ENSG00000229913
Gene Name: RP11-378I13.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
266-284
0.028
6
6mer
1464-1477
0.010
6
XLOC_000847
hsa-miR-34b-3p
0.839

Gene Details
Chromosome: chr1
Transcript: TCONS_00000080
Biotype: transcript isomorph
Gene id: XLOC_000847
Gene Name: XLOC_000847
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
257-275
0.028
6
6mer
1455-1468
0.010
6
XLOC_008895
hsa-miR-34b-3p
0.838

Gene Details
Chromosome: chr10
Transcript: TCONS_00018569
Biotype: transcript isomorph
Gene id: XLOC_008895
Gene Name: XLOC_008895
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Lung Normal/Primary
- Placenta Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1665-1686
0.031
6
6mer
1008-1019
0.007
5
AC005609.20
hsa-miR-34b-3p
0.836

Gene Details
Chromosome: 5
Transcript: ENST00000625071
Biotype: antisense
Gene id: ENSG00000278946
Gene Name: AC005609.20
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
141-154
0.022
4
7mer
405-425
0.016
Not Conserved
LINC01247
hsa-miR-34b-3p
0.835

Gene Details
Chromosome: 2
Transcript: ENST00000448901
Biotype: lincRNA
Gene id: ENSG00000227007
Gene Name: LINC01247
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
4107-4122
0.015
3
6mer
58-68
0.008
5
7mer
1755-1769
0.005
2
6mer
490-503
0.005
3
6mer
2990-3010
0.002
2
6mer
1401-1420
0.002
2
XLOC_001137
hsa-miR-34b-3p
0.834

Gene Details
Chromosome: chr1
Transcript: TCONS_00000709
Biotype: transcript isomorph
Gene id: XLOC_001137
Gene Name: XLOC_001137
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1194-1215
0.037
5
RP11-423C15.3
hsa-miR-34b-3p
0.833

Gene Details
Chromosome: 9
Transcript: ENST00000444800
Biotype: lincRNA
Gene id: ENSG00000229582
Gene Name: RP11-423C15.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
26-45
0.037
2
RP11-107N7.1
hsa-miR-34b-3p
0.832

Gene Details
Chromosome: 5
Transcript: ENST00000523413
Biotype: lincRNA
Gene id: ENSG00000253572
Gene Name: RP11-107N7.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
536-542
0.022
1
7mer
509-525
0.015
2
LINC01005
hsa-miR-34b-3p
0.832

Gene Details
Chromosome: 7
Transcript: ENST00000441691
Biotype: antisense
Gene id: ENSG00000228564
Gene Name: LINC01005
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
495-512
0.023
2
7mer
131-142
0.014
1
RP11-356J5.12
hsa-miR-34b-3p
0.832

Gene Details
Chromosome: 11
Transcript: ENST00000529938
Biotype: lincRNA
Gene id: ENSG00000250303
Gene Name: RP11-356J5.12
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1057-1083
0.034
7
6mer
132-156
0.003
Not Conserved
LINC00238
hsa-miR-34b-3p
0.832

Gene Details
Chromosome: 14
Transcript: ENST00000389594
Biotype: lincRNA
Gene id: ENSG00000196553
Gene Name: LINC00238
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
752-765
0.037
7
XLOC_009222
hsa-miR-34b-3p
0.831

Gene Details
Chromosome: chr11
Transcript: TCONS_00019399
Biotype: transcript isomorph
Gene id: XLOC_009222
Gene Name: XLOC_009222
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
6110-6115
0.037
1
RP11-24M17.4
hsa-miR-34b-3p
0.830

Gene Details
Chromosome: 15
Transcript: ENST00000623240
Biotype: TEC
Gene id: ENSG00000260288
Gene Name: RP11-24M17.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
575-599
0.016
2
6mer
1137-1154
0.015
2
6mer
1251-1274
0.006
1
LINC01277
hsa-miR-34b-3p
0.830

Gene Details
Chromosome: 6
Transcript: ENST00000446115
Biotype: lincRNA
Gene id: ENSG00000229017
Gene Name: LINC01277
UCSC graphic:
Expression:
  Cell Line Tissue Category
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
44-61
0.037
2
CTD-3018O17.3
hsa-miR-34b-3p
0.829

Gene Details
Chromosome: 19
Transcript: ENST00000598892
Biotype: retained_intron
Gene id: ENSG00000269834
Gene Name: CTD-3018O17.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
369-382
0.036
2
RP11-814P5.1
hsa-miR-34b-3p
0.827

Gene Details
Chromosome: 15
Transcript: ENST00000503496
Biotype: antisense
Gene id: ENSG00000250007
Gene Name: RP11-814P5.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2142-2163
0.036
2
LINC00448
hsa-miR-34b-3p
0.827

Gene Details
Chromosome: 13
Transcript: ENST00000438352
Biotype: lincRNA
Gene id: ENSG00000228669
Gene Name: LINC00448
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
77-93
0.036
2
RP1-309I22.2
hsa-miR-34b-3p
0.826

Gene Details
Chromosome: 22
Transcript: ENST00000624184
Biotype: sense_overlapping
Gene id: ENSG00000279338
Gene Name: RP1-309I22.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1268-1274
0.010
5
8mer
6148-6173
0.005
4
7mer
27314-27329
0.003
2
7mer
2366-2390
0.003
2
7mer
13723-13744
0.002
2
7mer
8584-8597
0.002
1
6mer
4294-4316
0.002
2
6mer
24337-24364
0.002
5
6mer
8454-8458
0.002
2
6mer
8913-8932
0.001
1
6mer
9168-9189
0.001
3
6mer
3873-3899
0.001
1
RP11-492E3.2
hsa-miR-34b-3p
0.826

Gene Details
Chromosome: 9
Transcript: ENST00000443993
Biotype: antisense
Gene id: ENSG00000227619
Gene Name: RP11-492E3.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1761-1767
0.021
2
6mer
2417-2439
0.006
1
7mer
611-624
0.005
Not Conserved
6mer
1858-1876
0.003
2
6mer
1120-1147
0.002
1
XLOC_011023
hsa-miR-34b-3p
0.826

Gene Details
Chromosome: chr14
Transcript: TCONS_00022745
Biotype: transcript isomorph
Gene id: XLOC_011023
Gene Name: XLOC_011023
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
589-611
0.017
3
7mer
846-854
0.012
2
7mer
583-602
0.007
3
Funded by: