Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-34b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-614F17.2
hsa-miR-34b-3p
0.825

Gene Details
Chromosome: 4
Transcript: ENST00000514222
Biotype: lincRNA
Gene id: ENSG00000251676
Gene Name: RP11-614F17.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
282-302
0.023
2
6mer
392-418
0.014
2
RP11-142O6.1
hsa-miR-34b-3p
0.825

Gene Details
Chromosome: 17
Transcript: ENST00000584382
Biotype: sense_intronic
Gene id: ENSG00000266371
Gene Name: RP11-142O6.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2619-2631
0.031
2
6mer
1602-1616
0.005
1
XLOC_010575
hsa-miR-34b-3p
0.825

Gene Details
Chromosome: chr13
Transcript: TCONS_00021974
Biotype: transcript isomorph
Gene id: XLOC_010575
Gene Name: XLOC_010575
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1638-1657
0.019
2
7mer
1990-2003
0.009
2
6mer
734-744
0.004
2
6mer
985-989
0.004
2
CTB-49A3.4
hsa-miR-34b-3p
0.824

Gene Details
Chromosome: 5
Transcript: ENST00000507403
Biotype: antisense
Gene id: ENSG00000250244
Gene Name: CTB-49A3.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
100-105
0.036
12
RP11-555K2.4
hsa-miR-34b-3p
0.824

Gene Details
Chromosome: 21
Transcript: ENST00000623559
Biotype: lincRNA
Gene id: ENSG00000279321
Gene Name: RP11-555K2.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
282-302
0.023
2
6mer
392-418
0.013
2
TMEM44-AS1
hsa-miR-34b-3p
0.823

Gene Details
Chromosome: 3
Transcript: NR_047574.1
Biotype: antisense
Gene id: NR_047574.1 (gene)
Gene Name: TMEM44-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
834-848
0.022
2
6mer
1339-1365
0.008
4
6mer
1360-1385
0.006
2
XLOC_007123
hsa-miR-34b-3p
0.823

Gene Details
Chromosome: chr8
Transcript: TCONS_00014521
Biotype: transcript isomorph
Gene id: XLOC_007123
Gene Name: XLOC_007123
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
A549 Lung Cancer/Malignant
Fibroblasts Lung Normal/Primary
- Placenta Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1035-1061
0.017
1
8mer
892-915
0.011
Not Conserved
6mer
926-949
0.007
5
CASC9
hsa-miR-34b-3p
0.823

Gene Details
Chromosome: 8
Transcript: ENST00000504531
Biotype: lincRNA
Gene id: ENSG00000249395
Gene Name: CASC9
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1057-1083
0.017
1
8mer
914-937
0.011
Not Conserved
6mer
948-971
0.007
5
TMEM44-AS1
hsa-miR-34b-3p
0.822

Gene Details
Chromosome: 3
Transcript: NR_047573.1
Biotype: antisense
Gene id: NR_047573.1 (gene)
Gene Name: TMEM44-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
838-852
0.022
2
6mer
1343-1369
0.008
4
6mer
1364-1389
0.005
2
RP11-65J21.3
hsa-miR-34b-3p
0.822

Gene Details
Chromosome: 16
Transcript: ENST00000570945
Biotype: lincRNA
Gene id: ENSG00000262454
Gene Name: RP11-65J21.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
567-589
0.036
8
XLOC_006118
hsa-miR-34b-3p
0.820

Gene Details
Chromosome: chr7
Transcript: TCONS_00013467
Biotype: transcript isomorph
Gene id: XLOC_006118
Gene Name: XLOC_006118
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
196-209
0.014
1
6mer
5532-5548
0.006
1
6mer
5195-5215
0.006
1
6mer
651-655
0.004
1
7mer
3334-3353
0.004
Not Conserved
7mer
2054-2069
0.002
1
RP13-143G15.4
hsa-miR-34b-3p
0.818

Gene Details
Chromosome: 6
Transcript: ENST00000585946
Biotype: antisense
Gene id: ENSG00000237596
Gene Name: RP13-143G15.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
21-36
0.035
1
XLOC_000166
hsa-miR-34b-3p
0.818

Gene Details
Chromosome: chr1
Transcript: TCONS_00002016
Biotype: transcript isomorph
Gene id: XLOC_000166
Gene Name: XLOC_000166
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
299-312
0.021
1
6mer
367-383
0.006
2
6mer
784-796
0.006
2
6mer
125-139
0.002
Not Conserved
RP11-3B12.2
hsa-miR-34b-3p
0.817

Gene Details
Chromosome: 7
Transcript: NR_110188.1
Biotype: lincRNA
Gene id: NR_110188.1 (gene)
Gene Name: RP11-3B12.2
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1177-1182
0.028
7
7mer
388-413
0.007
1
RP11-140M13.1
hsa-miR-34b-3p
0.816

Gene Details
Chromosome: 4
Transcript: ENST00000503093
Biotype: lincRNA
Gene id: ENSG00000251416
Gene Name: RP11-140M13.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
18-23
0.035
4
XLOC_001751
hsa-miR-34b-3p
0.816

Gene Details
Chromosome: chr2
Transcript: TCONS_00003048
Biotype: transcript isomorph
Gene id: XLOC_001751
Gene Name: XLOC_001751
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
273-284
0.035
1
RP11-31I22.2
hsa-miR-34b-3p
0.816

Gene Details
Chromosome: 17
Transcript: ENST00000584863
Biotype: antisense
Gene id: ENSG00000265115
Gene Name: RP11-31I22.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
455-468
0.035
3
XLOC_014297
hsa-miR-34b-3p
0.816

Gene Details
Chromosome: chr22
Transcript: TCONS_00029645
Biotype: transcript isomorph
Gene id: XLOC_014297
Gene Name: XLOC_014297
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Colon Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
93-98
0.022
Not Conserved
6mer
310-322
0.005
2
6mer
550-567
0.003
1
6mer
390-402
0.003
1
6mer
470-482
0.002
1
RP11-77E14.2
hsa-miR-34b-3p
0.815

Gene Details
Chromosome: 9
Transcript: ENST00000609091
Biotype: lincRNA
Gene id: ENSG00000273056
Gene Name: RP11-77E14.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
274-299
0.035
2
XLOC_008522
hsa-miR-34b-3p
0.815

Gene Details
Chromosome: chr10
Transcript: TCONS_00018246
Biotype: transcript isomorph
Gene id: XLOC_008522
Gene Name: XLOC_008522
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-34b-3p
Sequence: caaucacuaacuccacugccau
MirBase ID: MIMAT0004676
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
219-244
0.021
5
6mer
3584-3588
0.007
5
6mer
2042-2061
0.003
6
6mer
3194-3215
0.002
3
6mer
1576-1590
0.001
2
Funded by: