Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-548h-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-165H23.1
hsa-miR-548h-5p
0.908

Gene Details
Chromosome: 9
Transcript: ENST00000566873
Biotype: lincRNA
Gene id: ENSG00000260995
Gene Name: RP11-165H23.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2335-2360
0.037
2
8mer
750-770
0.011
2
XLOC_003061
hsa-miR-548h-5p
0.908

Gene Details
Chromosome: chr3
Transcript: TCONS_00007127
Biotype: transcript isomorph
Gene id: XLOC_003061
Gene Name: XLOC_003061
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
871-898
0.025
1
8mer+wobble
431-449
0.009
4
7mer
4888-4913
0.005
2
6mer
503-518
0.003
1
7mer
2330-2347
0.002
1
6mer
1224-1246
0.002
2
6mer
5845-5868
0.002
2
RP3-486I3.7
hsa-miR-548h-5p
0.908

Gene Details
Chromosome: 6
Transcript: ENST00000448740
Biotype: lincRNA
Gene id: ENSG00000237021
Gene Name: RP3-486I3.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
158-173
0.014
1
8mer
1476-1487
0.014
2
7mer
1871-1896
0.012
4
8mer
1115-1141
0.008
3
RP11-94H18.1
hsa-miR-548h-5p
0.908

Gene Details
Chromosome: 8
Transcript: ENST00000517356
Biotype: lincRNA
Gene id: ENSG00000248964
Gene Name: RP11-94H18.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Lymph Node Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
606-625
0.048
7
AC159540.1
hsa-miR-548h-5p
0.907

Gene Details
Chromosome: 2
Transcript: NR_103733.1
Biotype: lincRNA
Gene id: NR_103733.1 (gene)
Gene Name: AC159540.1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
570-583
0.035
1
7mer
618-640
0.013
1
XLOC_010719
hsa-miR-548h-5p
0.907

Gene Details
Chromosome: chr13
Transcript: TCONS_00022108
Biotype: transcript isomorph
Gene id: XLOC_010719
Gene Name: XLOC_010719
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
312-332
0.045
6
6mer
3234-3260
0.003
1
RP11-94H18.1
hsa-miR-548h-5p
0.907

Gene Details
Chromosome: 8
Transcript: ENST00000507496
Biotype: lincRNA
Gene id: ENSG00000248964
Gene Name: RP11-94H18.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Lymph Node Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
606-625
0.048
7
RP11-1143G9.5
hsa-miR-548h-5p
0.906

Gene Details
Chromosome: 12
Transcript: ENST00000613291
Biotype: lincRNA
Gene id: ENSG00000274979
Gene Name: RP11-1143G9.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1108-1123
0.019
2
7mer
821-834
0.009
2
8mer
1649-1655
0.008
1
6mer
3639-3643
0.004
2
6mer
2307-2317
0.003
2
6mer
2207-2220
0.002
2
7mer
2286-2300
0.001
2
XLOC_002749
hsa-miR-548h-5p
0.906

Gene Details
Chromosome: chr3
Transcript: TCONS_00006148
Biotype: transcript isomorph
Gene id: XLOC_002749
Gene Name: XLOC_002749
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
- Breast Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2381-2399
0.015
2
7mer
2683-2699
0.013
2
8mer
1871-1893
0.008
2
8mer
2405-2424
0.008
2
7mer
1456-1483
0.002
3
6mer
2171-2196
0.002
1
PCA3
hsa-miR-548h-5p
0.905

Gene Details
Chromosome: 9
Transcript: ENST00000412654
Biotype: antisense
Gene id: ENSG00000225937
Gene Name: PCA3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
3503-3528
0.029
4
6mer
3713-3724
0.007
2
6mer
3557-3581
0.005
2
6mer
1193-1214
0.004
5
6mer
2908-2917
0.003
2
RP11-13E5.2
hsa-miR-548h-5p
0.905

Gene Details
Chromosome: X
Transcript: ENST00000438994
Biotype: lincRNA
Gene id: ENSG00000237208
Gene Name: RP11-13E5.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
459-479
0.048
4
SNORA72
hsa-miR-548h-5p
0.905

Gene Details
Chromosome: 8
Transcript: ENST00000501016
Biotype: antisense
Gene id: ENSG00000245970
Gene Name: SNORA72
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
66-82
0.015
5
8mer
588-606
0.014
3
7mer
1395-1411
0.009
1
6mer
526-553
0.006
3
6mer
231-249
0.004
Not Conserved
XLOC_006340
hsa-miR-548h-5p
0.905

Gene Details
Chromosome: chr7
Transcript: TCONS_00013678
Biotype: transcript isomorph
Gene id: XLOC_006340
Gene Name: XLOC_006340
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary
- Lung Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
244-261
0.028
1
8mer
103-126
0.020
1
PCA3
hsa-miR-548h-5p
0.905

Gene Details
Chromosome: 9
Transcript: NR_015342.1
Biotype: antisense
Gene id: NR_015342.1 (gene)
Gene Name: PCA3
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
3336-3361
0.030
4
6mer
3546-3557
0.007
2
6mer
1026-1047
0.004
5
6mer
3390-3414
0.004
2
6mer
2741-2750
0.004
2
RP5-1014D13.2
hsa-miR-548h-5p
0.905

Gene Details
Chromosome: 22
Transcript: ENST00000623726
Biotype: sense_overlapping
Gene id: ENSG00000279738
Gene Name: RP5-1014D13.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
10745-10770
0.010
1
7mer
4505-4526
0.008
2
6mer
443-464
0.004
Not Conserved
7mer
11867-11890
0.004
2
6mer
19241-19257
0.004
2
7mer
5838-5859
0.003
1
6mer
1667-1686
0.003
5
6mer
6201-6214
0.002
2
6mer
5036-5046
0.002
2
6mer
9482-9497
0.002
Not Conserved
6mer
8000-8023
0.002
1
6mer
2162-2187
0.002
1
6mer
3533-3547
0.001
Not Conserved
XLOC_007688
hsa-miR-548h-5p
0.904

Gene Details
Chromosome: chr9
Transcript: TCONS_00015809
Biotype: transcript isomorph
Gene id: XLOC_007688
Gene Name: XLOC_007688
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Lung Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4-19
0.038
Not Conserved
6mer
188-203
0.009
1
XLOC_014394
hsa-miR-548h-5p
0.904

Gene Details
Chromosome: chr22
Transcript: TCONS_00029713
Biotype: transcript isomorph
Gene id: XLOC_014394
Gene Name: XLOC_014394
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
165-184
0.047
1
LINC01206
hsa-miR-548h-5p
0.904

Gene Details
Chromosome: 3
Transcript: ENST00000482787
Biotype: lincRNA
Gene id: ENSG00000242512
Gene Name: LINC01206
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
9425-9445
0.014
3
8mer
8801-8811
0.010
2
8mer
8194-8218
0.007
1
7mer
5006-5027
0.005
1
6mer
5400-5424
0.004
6
6mer
5684-5699
0.003
3
6mer
2240-2265
0.002
2
6mer
7475-7491
0.001
2
6mer
8297-8322
0.001
3
CTD-2036P10.3
hsa-miR-548h-5p
0.904

Gene Details
Chromosome: 15
Transcript: ENST00000500850
Biotype: lincRNA
Gene id: ENSG00000246283
Gene Name: CTD-2036P10.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
95-119
0.026
2
7mer
1539-1560
0.011
5
7mer
646-670
0.005
3
6mer
1042-1066
0.005
6
FLJ31306
hsa-miR-548h-5p
0.903

Gene Details
Chromosome: 14
Transcript: ENST00000557412
Biotype: antisense
Gene id: ENSG00000257621
Gene Name: FLJ31306
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
527-541
0.034
2
6mer
383-405
0.007
2
6mer
491-514
0.006
2
Funded by: