Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-548h-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_011693
hsa-miR-548h-5p
0.990

Gene Details
Chromosome: chr16
Transcript: TCONS_00024250
Biotype: transcript isomorph
Gene id: XLOC_011693
Gene Name: XLOC_011693
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1581-1601
0.055
1
6mer
1668-1693
0.017
1
7mer
1379-1405
0.015
1
RP11-108P20.1
hsa-miR-548h-5p
0.989

Gene Details
Chromosome: 18
Transcript: ENST00000592021
Biotype: lincRNA
Gene id: ENSG00000267010
Gene Name: RP11-108P20.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
129-155
0.031
2
9mer
219-243
0.017
1
9mer
269-286
0.014
2
7mer
2169-2195
0.009
2
6mer
2123-2145
0.008
2
6mer
1748-1771
0.006
2
RP11-634B7.4
hsa-miR-548h-5p
0.989

Gene Details
Chromosome: 1
Transcript: ENST00000582218
Biotype: antisense
Gene id: ENSG00000235749
Gene Name: RP11-634B7.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
29-44
0.084
2
RP4-740C4.7
hsa-miR-548h-5p
0.989

Gene Details
Chromosome: 1
Transcript: ENST00000607858
Biotype: sense_intronic
Gene id: ENSG00000272420
Gene Name: RP4-740C4.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
362-371
0.084
1
RP11-142O6.1
hsa-miR-548h-5p
0.989

Gene Details
Chromosome: 17
Transcript: ENST00000584382
Biotype: sense_intronic
Gene id: ENSG00000266371
Gene Name: RP11-142O6.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
387-410
0.034
2
7mer
207-222
0.033
2
7mer
1603-1627
0.010
1
6mer
1042-1065
0.005
1
6mer
1617-1641
0.002
1
LINC01194
hsa-miR-548h-5p
0.988

Gene Details
Chromosome: 5
Transcript: ENST00000505877
Biotype: lincRNA
Gene id: ENSG00000248131
Gene Name: LINC01194
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
406-430
0.037
2
7mer
656-672
0.014
2
6mer
1124-1143
0.013
2
7mer
784-795
0.011
2
6mer
757-780
0.007
2
CTD-2311B13.2
hsa-miR-548h-5p
0.987

Gene Details
Chromosome: 14
Transcript: ENST00000549951
Biotype: lincRNA
Gene id: ENSG00000258265
Gene Name: CTD-2311B13.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
248-268
0.081
2
XLOC_004054
hsa-miR-548h-5p
0.986

Gene Details
Chromosome: chr4
Transcript: TCONS_00009112
Biotype: transcript isomorph
Gene id: XLOC_004054
Gene Name: XLOC_004054
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
281-298
0.040
5
9mer
507-532
0.023
1
7mer
266-271
0.011
3
6mer
748-755
0.007
4
LINC01087
hsa-miR-548h-5p
0.986

Gene Details
Chromosome: 2
Transcript: ENST00000431979
Biotype: lincRNA
Gene id: ENSG00000224559
Gene Name: LINC01087
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
692-707
0.027
1
9mer
2907-2927
0.023
1
7mer
2986-2998
0.011
2
7mer
1957-1973
0.009
1
7mer
1359-1379
0.006
1
6mer
1165-1183
0.004
1
RP11-1000B6.7
hsa-miR-548h-5p
0.986

Gene Details
Chromosome: 15
Transcript: ENST00000616244
Biotype: sense_intronic
Gene id: ENSG00000276724
Gene Name: RP11-1000B6.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
200-213
0.057
1
6mer
142-157
0.023
1
XLOC_013093
hsa-miR-548h-5p
0.983

Gene Details
Chromosome: chr19
Transcript: TCONS_00027051
Biotype: transcript isomorph
Gene id: XLOC_013093
Gene Name: XLOC_013093
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
3060-3077
0.025
3
8mer
2759-2765
0.022
1
7mer
1025-1052
0.009
2
6mer
2768-2778
0.007
1
7mer
1889-1903
0.007
2
6mer
1741-1755
0.007
2
RP11-748L13.6
hsa-miR-548h-5p
0.982

Gene Details
Chromosome: 10
Transcript: ENST00000568270
Biotype: lincRNA
Gene id: ENSG00000260151
Gene Name: RP11-748L13.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
915-936
0.024
2
8mer
693-705
0.015
2
6mer
1372-1386
0.014
2
7mer
83-99
0.013
2
7mer
1321-1342
0.011
1
AC159540.1
hsa-miR-548h-5p
0.982

Gene Details
Chromosome: 2
Transcript: ENST00000610408
Biotype: lincRNA
Gene id: ENSG00000230606
Gene Name: AC159540.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
68-81
0.038
1
8mer
2193-2217
0.022
2
7mer
11-33
0.015
1
HAND2-AS1
hsa-miR-548h-5p
0.981

Gene Details
Chromosome: 4
Transcript: ENST00000507571
Biotype: antisense
Gene id: ENSG00000237125
Gene Name: HAND2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1853-1874
0.016
7
8mer
1640-1661
0.013
6
8mer
1085-1101
0.010
3
6mer
408-432
0.010
8
7mer
685-705
0.008
1
9mer
1930-1947
0.008
5
6mer
714-728
0.005
9
6mer
502-528
0.004
5
6mer
1715-1734
0.001
1
RP5-857K21.3
hsa-miR-548h-5p
0.980

Gene Details
Chromosome: 1
Transcript: ENST00000440196
Biotype: lincRNA
Gene id: ENSG00000239664
Gene Name: RP5-857K21.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
100-115
0.068
1
7mer
170-182
0.007
Not Conserved
NEAT1
hsa-miR-548h-5p
0.980

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
9682-9696
0.011
3
9mer
11651-11667
0.010
1
8mer
9061-9075
0.007
2
7mer
14989-15012
0.006
3
7mer
14743-14769
0.005
3
7mer
18952-18957
0.004
2
6mer
832-853
0.004
2
8mer
9140-9152
0.003
2
6mer
18501-18528
0.003
2
6mer
6358-6381
0.002
2
6mer
7846-7863
0.002
1
7mer
19053-19066
0.002
3
6mer
15663-15686
0.002
2
6mer
8073-8081
0.002
2
7mer
9194-9218
0.002
1
6mer
3999-4023
0.002
3
6mer
15335-15352
0.002
1
6mer
16405-16421
0.002
2
6mer
18664-18678
0.002
2
6mer
8185-8200
0.002
2
6mer
18200-18226
0.001
2
6mer
8265-8283
0.001
2
LINC00662
hsa-miR-548h-5p
0.980

Gene Details
Chromosome: 19
Transcript: ENST00000590523
Biotype: lincRNA
Gene id: ENSG00000261824
Gene Name: LINC00662
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
139-166
0.024
1
7mer
187-199
0.022
1
7mer
482-495
0.015
1
7mer
1115-1129
0.015
1
LINC00662
hsa-miR-548h-5p
0.980

Gene Details
Chromosome: 19
Transcript: NR_027301.1
Biotype: lincRNA
Gene id: NR_027301.1 (gene)
Gene Name: LINC00662
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
137-164
0.024
1
7mer
185-197
0.021
1
7mer
480-493
0.015
1
7mer
1113-1127
0.015
1
LOC100128885
hsa-miR-548h-5p
0.978

Gene Details
Chromosome: 7
Transcript: NR_077227.1
Biotype: lincRNA
Gene id: NR_077227.1 (gene)
Gene Name: LOC100128885
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
196-216
0.063
2
6mer
4282-4308
0.007
1
6mer
3116-3136
0.004
1
LINC00342
hsa-miR-548h-5p
0.978

Gene Details
Chromosome: 2
Transcript: ENST00000448494
Biotype: lincRNA
Gene id: ENSG00000232931
Gene Name: LINC00342
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
68-81
0.032
1
8mer
1825-1849
0.023
2
7mer
11-34
0.017
1
6mer
1095-1118
0.002
1
Funded by: