Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-548h-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
HAND2-AS1
hsa-miR-548h-5p
0.978

Gene Details
Chromosome: 4
Transcript: ENST00000515350
Biotype: antisense
Gene id: ENSG00000237125
Gene Name: HAND2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1930-1951
0.016
7
8mer
1717-1738
0.013
6
6mer
486-509
0.009
8
8mer
1162-1178
0.009
3
9mer
2007-2024
0.008
5
7mer
762-782
0.008
1
6mer
791-805
0.005
9
6mer
579-605
0.004
5
6mer
1792-1811
0.001
1
LINC01088
hsa-miR-548h-5p
0.978

Gene Details
Chromosome: 4
Transcript: ENST00000513153
Biotype: antisense
Gene id: ENSG00000249307
Gene Name: LINC01088
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
592-612
0.054
12
6mer
646-664
0.018
12
RP11-386J22.3
hsa-miR-548h-5p
0.977

Gene Details
Chromosome: 9
Transcript: ENST00000622201
Biotype: sense_intronic
Gene id: ENSG00000274421
Gene Name: RP11-386J22.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
959-978
0.038
2
6mer
661-683
0.013
2
7mer
897-915
0.013
1
6mer
266-281
0.008
1
LINC01088
hsa-miR-548h-5p
0.977

Gene Details
Chromosome: 4
Transcript: ENST00000511241
Biotype: antisense
Gene id: ENSG00000249307
Gene Name: LINC01088
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
575-595
0.056
12
6mer
629-647
0.016
12
RP11-796E2.4
hsa-miR-548h-5p
0.977

Gene Details
Chromosome: 12
Transcript: ENST00000499685
Biotype: antisense
Gene id: ENSG00000245904
Gene Name: RP11-796E2.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
289-310
0.023
7
8mer
389-415
0.019
4
8mer
5153-5170
0.014
2
7mer
2962-2984
0.004
2
6mer
888-910
0.004
2
6mer
314-331
0.004
2
6mer
4535-4553
0.004
3
6mer
3143-3164
0.001
2
RP11-679C8.2
hsa-miR-548h-5p
0.976

Gene Details
Chromosome: 4
Transcript: ENST00000503073
Biotype: antisense
Gene id: ENSG00000250938
Gene Name: RP11-679C8.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
353-368
0.018
2
8mer
1010-1033
0.016
2
8mer
1996-2014
0.016
2
7mer
2017-2029
0.012
1
6mer
1853-1873
0.006
5
6mer
1861-1882
0.004
3
LINC01088
hsa-miR-548h-5p
0.976

Gene Details
Chromosome: 4
Transcript: ENST00000512130
Biotype: antisense
Gene id: ENSG00000249307
Gene Name: LINC01088
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
420-440
0.055
12
6mer
474-492
0.016
12
RP11-680F20.10
hsa-miR-548h-5p
0.976

Gene Details
Chromosome: 11
Transcript: ENST00000564354
Biotype: lincRNA
Gene id: ENSG00000260209
Gene Name: RP11-680F20.10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
116-131
0.056
1
6mer
479-502
0.015
1
XLOC_004451
hsa-miR-548h-5p
0.976

Gene Details
Chromosome: chr5
Transcript: TCONS_00009438
Biotype: transcript isomorph
Gene id: XLOC_004451
Gene Name: XLOC_004451
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Lung Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
995-1019
0.029
1
7mer
987-1005
0.018
2
6mer
419-440
0.010
2
6mer
977-1000
0.007
1
6mer
567-592
0.007
2
CTA-342B11.3
hsa-miR-548h-5p
0.976

Gene Details
Chromosome: 22
Transcript: ENST00000624235
Biotype: lincRNA
Gene id: ENSG00000280370
Gene Name: CTA-342B11.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
24403-24422
0.014
1
8mer
21562-21576
0.009
Not Conserved
8mer
9681-9707
0.006
1
7mer
8402-8407
0.006
2
7mer
23436-23462
0.005
1
7mer
3677-3697
0.005
2
6mer
792-810
0.005
3
6mer
12981-13005
0.003
2
6mer
4281-4303
0.002
2
6mer
10060-10077
0.002
1
6mer
12647-12661
0.002
2
6mer
20088-20104
0.002
1
6mer
8900-8922
0.002
1
6mer
11391-11406
0.002
1
6mer
20442-20455
0.001
1
6mer
18836-18855
0.001
1
6mer
12686-12702
0.001
2
6mer
10142-10165
0.001
1
6mer
20192-20216
0.001
1
6mer
21619-21633
0.001
Not Conserved
6mer
18860-18886
0.001
2
CASC2
hsa-miR-548h-5p
0.975

Gene Details
Chromosome: 10
Transcript: ENST00000435944
Biotype: antisense
Gene id: ENSG00000177640
Gene Name: CASC2
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3201-3226
0.058
4
7mer
3094-3105
0.009
1
6mer
1204-1228
0.004
5
XLOC_000650
hsa-miR-548h-5p
0.975

Gene Details
Chromosome: chr1
Transcript: TCONS_00001363
Biotype: transcript isomorph
Gene id: XLOC_000650
Gene Name: XLOC_000650
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Colon Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
359-374
0.070
2
ZNRD1-AS1
hsa-miR-548h-5p
0.974

Gene Details
Chromosome: 6
Transcript: ENST00000444051
Biotype: antisense
Gene id: ENSG00000204623
Gene Name: ZNRD1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
262-273
0.019
2
7mer
721-744
0.018
2
6mer
254-258
0.010
2
7mer
3782-3802
0.006
1
6mer
5776-5794
0.005
2
6mer
5311-5330
0.004
2
6mer
4088-4098
0.004
1
6mer
7328-7349
0.004
2
XLOC_006242
hsa-miR-548h-5p
0.974

Gene Details
Chromosome: chr7
Transcript: TCONS_00014209
Biotype: transcript isomorph
Gene id: XLOC_006242
Gene Name: XLOC_006242
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
564-586
0.044
2
7mer
1979-1996
0.014
1
7mer
1627-1642
0.012
1
FAM66C
hsa-miR-548h-5p
0.973

Gene Details
Chromosome: 12
Transcript: ENST00000544214
Biotype: antisense
Gene id: ENSG00000226711
Gene Name: FAM66C
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2143-2162
0.048
2
6mer
2171-2195
0.015
2
6mer
1330-1355
0.006
2
PCAT14
hsa-miR-548h-5p
0.972

Gene Details
Chromosome: 22
Transcript: NR_109832.1
Biotype: lincRNA
Gene id: NR_109832.1 (gene)
Gene Name: PCAT14
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
919-931
0.052
1
7mer
884-905
0.017
1
HAND2-AS1
hsa-miR-548h-5p
0.972

Gene Details
Chromosome: 4
Transcript: ENST00000510339
Biotype: antisense
Gene id: ENSG00000237125
Gene Name: HAND2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2065-2086
0.015
7
8mer
1852-1873
0.014
6
6mer
621-644
0.008
8
8mer
1297-1313
0.008
3
9mer
2142-2159
0.008
5
7mer
897-917
0.007
1
6mer
926-940
0.004
9
6mer
714-740
0.003
5
6mer
1927-1946
0.001
1
HAND2-AS1
hsa-miR-548h-5p
0.971

Gene Details
Chromosome: 4
Transcript: ENST00000507062
Biotype: antisense
Gene id: ENSG00000237125
Gene Name: HAND2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2930-2951
0.015
7
8mer
2717-2738
0.013
6
6mer
48-73
0.010
5
9mer
3007-3024
0.008
5
8mer
2162-2178
0.007
3
7mer
1762-1782
0.004
1
6mer
1486-1509
0.004
8
7mer
1247-1271
0.002
1
6mer
1791-1805
0.002
9
6mer
1579-1605
0.001
5
6mer
2792-2811
0.001
1
RP11-346C4.3
hsa-miR-548h-5p
0.971

Gene Details
Chromosome: 13
Transcript: ENST00000622038
Biotype: lincRNA
Gene id: ENSG00000274718
Gene Name: RP11-346C4.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2915-2932
0.029
3
8mer
2547-2572
0.021
2
8mer
1172-1195
0.012
2
6mer
925-947
0.003
2
6mer
1932-1952
0.003
2
MIR6818
hsa-miR-548h-5p
0.970

Gene Details
Chromosome: 22
Transcript: ENST00000624945
Biotype: antisense
Gene id: ENSG00000279159
Gene Name: MIR6818
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
146-164
0.007
1
8mer
45355-45361
0.006
1
7mer
30179-30199
0.005
11
7mer
2936-2963
0.004
6
7mer
9223-9243
0.004
2
7mer
8572-8594
0.003
2
6mer
48585-48600
0.003
2
6mer
5894-5920
0.003
4
6mer
27262-27283
0.003
4
6mer
25223-25248
0.003
7
6mer
41159-41184
0.002
5
6mer
14951-14969
0.002
4
7mer
45798-45815
0.002
2
6mer
15990-16000
0.002
2
6mer
3979-3993
0.002
2
6mer
14681-14695
0.002
1
6mer
20561-20585
0.002
2
6mer
13683-13701
0.002
3
6mer
30587-30601
0.002
2
6mer
7015-7032
0.002
2
7mer
25142-25160
0.001
3
6mer
32718-32743
0.001
1
6mer
34008-34027
0.001
2
6mer
33870-33887
0.001
2
6mer
34117-34132
0.001
1
6mer
27236-27249
0.001
2
Funded by: