Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-548h-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
CTD-2008P7.1
hsa-miR-548h-5p
0.969

Gene Details
Chromosome: 17
Transcript: ENST00000564762
Biotype: lincRNA
Gene id: ENSG00000260777
Gene Name: CTD-2008P7.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
919-933
0.032
2
8mer
2447-2465
0.028
2
7mer
1832-1849
0.006
1
HAND2-AS1
hsa-miR-548h-5p
0.967

Gene Details
Chromosome: 4
Transcript: ENST00000508534
Biotype: antisense
Gene id: ENSG00000237125
Gene Name: HAND2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1801-1822
0.015
7
8mer
1588-1609
0.013
6
8mer
1033-1049
0.010
3
7mer
633-653
0.009
1
9mer
1878-1895
0.007
5
6mer
662-676
0.006
9
6mer
450-476
0.005
5
6mer
1663-1682
0.001
1
RP11-509J21.2
hsa-miR-548h-5p
0.967

Gene Details
Chromosome: 9
Transcript: ENST00000430387
Biotype: lincRNA
Gene id: ENSG00000237359
Gene Name: RP11-509J21.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
441-462
0.039
6
7mer
39-61
0.011
2
6mer
229-252
0.009
8
6mer
513-528
0.007
5
RP5-857K21.3
hsa-miR-548h-5p
0.966

Gene Details
Chromosome: 1
Transcript: ENST00000357876
Biotype: lincRNA
Gene id: ENSG00000239664
Gene Name: RP5-857K21.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
94-109
0.061
1
7mer
164-176
0.005
Not Conserved
RP11-67L2.2
hsa-miR-548h-5p
0.966

Gene Details
Chromosome: 3
Transcript: ENST00000610128
Biotype: lincRNA
Gene id: ENSG00000273033
Gene Name: RP11-67L2.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4920-4944
0.027
6
7mer
4980-4994
0.012
8
6mer
5104-5115
0.006
4
7mer
401-422
0.006
1
7mer
2797-2819
0.003
1
6mer
2453-2475
0.003
5
9mer
3843-3866
0.003
2
6mer
3809-3829
0.003
2
6mer
3946-3958
0.002
4
6mer
1408-1426
0.001
2
XLOC_001362
hsa-miR-548h-5p
0.966

Gene Details
Chromosome: chr2
Transcript: TCONS_00002688
Biotype: transcript isomorph
Gene id: XLOC_001362
Gene Name: XLOC_001362
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1931-1955
0.065
9
DLEU2
hsa-miR-548h-5p
0.966

Gene Details
Chromosome: 13
Transcript: ENST00000458725
Biotype: antisense
Gene id: ENSG00000231607
Gene Name: DLEU2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1570-1591
0.040
2
8mer
827-850
0.013
1
7mer
945-971
0.008
1
6mer
1162-1185
0.004
3
CTB-92J24.2
hsa-miR-548h-5p
0.965

Gene Details
Chromosome: 19
Transcript: ENST00000594230
Biotype: sense_intronic
Gene id: ENSG00000269397
Gene Name: CTB-92J24.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
644-655
0.034
1
7mer
1332-1352
0.024
1
7mer
651-670
0.006
Not Conserved
LINC01088
hsa-miR-548h-5p
0.965

Gene Details
Chromosome: 4
Transcript: ENST00000507476
Biotype: antisense
Gene id: ENSG00000249307
Gene Name: LINC01088
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
580-600
0.050
12
6mer
634-652
0.015
12
DLEU2
hsa-miR-548h-5p
0.964

Gene Details
Chromosome: 13
Transcript: ENST00000235290
Biotype: antisense
Gene id: ENSG00000231607
Gene Name: DLEU2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1652-1673
0.040
2
8mer
899-922
0.013
1
7mer
1017-1043
0.008
1
6mer
1234-1257
0.004
3
CTA-929C8.9
hsa-miR-548h-5p
0.962

Gene Details
Chromosome: 22
Transcript: ENST00000624278
Biotype: sense_intronic
Gene id: ENSG00000279185
Gene Name: CTA-929C8.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
9564-9584
0.009
2
7mer
19434-19461
0.005
1
9mer
3652-3677
0.004
1
7mer
15373-15389
0.004
2
7mer
11796-11806
0.004
2
7mer
9056-9075
0.003
2
7mer
11965-11985
0.003
1
6mer
13325-13343
0.003
2
7mer
13401-13413
0.003
3
6mer
10666-10670
0.002
1
7mer
11280-11305
0.002
1
7mer
15963-15985
0.002
1
6mer
14554-14562
0.002
1
7mer
10779-10797
0.002
2
6mer
7327-7347
0.002
2
7mer
11822-11837
0.002
2
6mer
7662-7688
0.002
1
6mer
15812-15821
0.002
1
7mer
9615-9624
0.002
1
6mer
15623-15645
0.002
2
6mer
8440-8464
0.002
1
6mer
22512-22532
0.002
1
6mer
10664-10680
0.001
2
XLOC_010816
hsa-miR-548h-5p
0.961

Gene Details
Chromosome: chr14
Transcript: TCONS_00022492
Biotype: transcript isomorph
Gene id: XLOC_010816
Gene Name: XLOC_010816
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1444-1461
0.027
1
9mer
574-585
0.016
1
7mer
411-438
0.010
2
7mer
940-960
0.005
1
6mer
1029-1045
0.003
1
6mer
635-648
0.002
1
KCNQ1OT1
hsa-miR-548h-5p
0.960

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
5575-5596
0.005
2
7mer
68917-68934
0.003
2
6mer
66347-66373
0.003
6
6mer
18886-18901
0.003
2
6mer
27366-27388
0.003
1
6mer
14216-14229
0.003
1
6mer
18461-18487
0.003
2
7mer
46642-46650
0.002
1
6mer
916-937
0.002
1
6mer
72004-72018
0.002
2
6mer
66565-66589
0.002
4
7mer
15072-15091
0.002
Not Conserved
6mer
13356-13374
0.002
2
6mer
88434-88450
0.002
2
6mer
63640-63657
0.002
2
6mer
6476-6503
0.002
2
6mer
88197-88215
0.002
2
6mer
13815-13832
0.002
2
6mer
5405-5409
0.002
2
6mer
55308-55320
0.002
2
6mer
55835-55857
0.002
2
6mer
71146-71164
0.002
1
6mer
52227-52245
0.002
2
6mer
20802-20819
0.002
2
6mer
48648-48665
0.002
2
6mer
2478-2498
0.001
2
6mer
76545-76564
0.001
1
6mer
17503-17528
0.001
2
6mer
71898-71915
0.001
Not Conserved
6mer
14119-14131
0.001
1
RP11-508N22.12
hsa-miR-548h-5p
0.960

Gene Details
Chromosome: 10
Transcript: ENST00000608335
Biotype: lincRNA
Gene id: ENSG00000272983
Gene Name: RP11-508N22.12
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
83-99
0.040
2
9mer
3006-3032
0.008
1
6mer
520-544
0.008
2
6mer
6498-6522
0.004
1
6mer
4651-4666
0.002
1
LINC00554
hsa-miR-548h-5p
0.960

Gene Details
Chromosome: 13
Transcript: ENST00000564841
Biotype: antisense
Gene id: ENSG00000260738
Gene Name: LINC00554
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
196-208
0.020
2
7mer
1654-1674
0.009
11
6mer
231-257
0.009
8
6mer
1998-2019
0.008
10
6mer
529-553
0.006
2
7mer
1291-1308
0.005
4
6mer
376-398
0.005
3
DNM3OS
hsa-miR-548h-5p
0.959

Gene Details
Chromosome: 1
Transcript: NR_038397.2
Biotype: antisense
Gene id: NR_038397.2 (gene)
Gene Name: DNM3OS
UCSC graphic: -
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
5362-5368
0.013
7
8mer
5642-5661
0.010
3
8mer
3576-3597
0.008
2
7mer
6240-6253
0.006
2
7mer
4402-4418
0.006
5
6mer
779-800
0.004
4
7mer
7200-7220
0.003
1
6mer
2195-2214
0.003
6
6mer
886-911
0.003
2
6mer
4727-4748
0.002
2
6mer
5104-5130
0.002
4
6mer
5903-5928
0.002
4
6mer
6127-6144
0.001
2
RP11-734K23.9
hsa-miR-548h-5p
0.958

Gene Details
Chromosome: 2
Transcript: ENST00000619371
Biotype: lincRNA
Gene id: ENSG00000277701
Gene Name: RP11-734K23.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
278-291
0.044
1
7mer
326-348
0.018
1
XLOC_007993
hsa-miR-548h-5p
0.957

Gene Details
Chromosome: chrX
Transcript: TCONS_00017181
Biotype: transcript isomorph
Gene id: XLOC_007993
Gene Name: XLOC_007993
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
910-935
0.041
3
7mer
427-435
0.011
2
7mer
677-688
0.009
2
RP11-421F16.3
hsa-miR-548h-5p
0.956

Gene Details
Chromosome: 12
Transcript: ENST00000500632
Biotype: antisense
Gene id: ENSG00000247903
Gene Name: RP11-421F16.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2259-2286
0.026
2
7mer
2140-2159
0.008
2
6mer
177-201
0.007
2
6mer
382-399
0.007
5
6mer
18-37
0.006
3
6mer
824-838
0.004
2
6mer
1219-1239
0.003
1
AC008271.1
hsa-miR-548h-5p
0.955

Gene Details
Chromosome: 2
Transcript: ENST00000492352
Biotype: lincRNA
Gene id: ENSG00000231031
Gene Name: AC008271.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1839-1863
0.061
9
Funded by: