Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-548h-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XXyac-YM21GA2.7
hsa-miR-548h-5p
0.954

Gene Details
Chromosome: 9
Transcript: ENST00000399186
Biotype: antisense
Gene id: ENSG00000214888
Gene Name: XXyac-YM21GA2.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
7-24
0.060
1
LINC01002
hsa-miR-548h-5p
0.953

Gene Details
Chromosome: 19
Transcript: ENST00000614841
Biotype: lincRNA
Gene id: ENSG00000206082
Gene Name: LINC01002
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
140-159
0.060
2
RP11-19E11.1
hsa-miR-548h-5p
0.953

Gene Details
Chromosome: 2
Transcript: ENST00000584273
Biotype: lincRNA
Gene id: ENSG00000258910
Gene Name: RP11-19E11.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
28-52
0.058
7
6mer
345-363
0.002
1
CTD-2076M15.1
hsa-miR-548h-5p
0.952

Gene Details
Chromosome: X
Transcript: ENST00000561587
Biotype: lincRNA
Gene id: ENSG00000260683
Gene Name: CTD-2076M15.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
291-315
0.038
1
6mer
803-829
0.011
2
6mer
161-178
0.011
1
CTD-2162K18.3
hsa-miR-548h-5p
0.952

Gene Details
Chromosome: 19
Transcript: ENST00000588717
Biotype: lincRNA
Gene id: ENSG00000267353
Gene Name: CTD-2162K18.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
269-289
0.023
2
6mer
451-474
0.011
2
6mer
12-35
0.010
1
6mer
719-737
0.010
2
6mer
1012-1030
0.006
2
FLG-AS1
hsa-miR-548h-5p
0.952

Gene Details
Chromosome: 1
Transcript: ENST00000382265
Biotype: antisense
Gene id: ENSG00000237975
Gene Name: FLG-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1280-1301
0.023
Not Conserved
8mer
1419-1436
0.020
1
9mer
1291-1314
0.017
1
CTD-2561J22.5
hsa-miR-548h-5p
0.951

Gene Details
Chromosome: 19
Transcript: ENST00000594557
Biotype: retained_intron
Gene id: ENSG00000268119
Gene Name: CTD-2561J22.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4075-4090
0.016
1
7mer
953-975
0.011
2
6mer
496-513
0.010
2
6mer
315-332
0.007
1
6mer
3644-3666
0.006
2
6mer
3164-3191
0.005
2
6mer
2218-2238
0.004
2
RP4-760C5.5
hsa-miR-548h-5p
0.950

Gene Details
Chromosome: 20
Transcript: ENST00000449316
Biotype: lincRNA
Gene id: ENSG00000226203
Gene Name: RP4-760C5.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
133-147
0.024
2
8mer
3804-3825
0.015
Not Conserved
7mer
4284-4303
0.008
Not Conserved
7mer
1116-1134
0.006
Not Conserved
6mer
932-957
0.004
1
6mer
1309-1328
0.002
Not Conserved
RP11-314D7.1
hsa-miR-548h-5p
0.950

Gene Details
Chromosome: 12
Transcript: ENST00000552541
Biotype: lincRNA
Gene id: ENSG00000258294
Gene Name: RP11-314D7.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
24-45
0.059
11
XLOC_013502
hsa-miR-548h-5p
0.950

Gene Details
Chromosome: chr20
Transcript: TCONS_00027863
Biotype: transcript isomorph
Gene id: XLOC_013502
Gene Name: XLOC_013502
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Ovary Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
128-142
0.024
2
8mer
3799-3820
0.015
Not Conserved
7mer
4279-4298
0.008
Not Conserved
7mer
1111-1129
0.006
Not Conserved
6mer
927-952
0.004
1
6mer
1304-1323
0.002
Not Conserved
RP11-837J7.4
hsa-miR-548h-5p
0.949

Gene Details
Chromosome: 12
Transcript: ENST00000612793
Biotype: antisense
Gene id: ENSG00000277299
Gene Name: RP11-837J7.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
321-335
0.027
5
7mer
355-371
0.021
8
6mer
479-497
0.010
8
BCYRN1
hsa-miR-548h-5p
0.948

Gene Details
Chromosome: 2
Transcript: ENST00000418539
Biotype: lincRNA
Gene id: ENSG00000236824
Gene Name: BCYRN1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
336-342
0.022
1
8mer
4564-4583
0.011
2
7mer
12574-12597
0.007
3
7mer
12082-12102
0.004
2
6mer
12332-12349
0.003
5
6mer
12729-12752
0.003
2
6mer
1104-1123
0.003
4
6mer
12488-12511
0.002
1
6mer
12210-12233
0.002
2
6mer
6257-6272
0.002
2
RP11-48B3.4
hsa-miR-548h-5p
0.948

Gene Details
Chromosome: 8
Transcript: ENST00000569134
Biotype: lincRNA
Gene id: ENSG00000260317
Gene Name: RP11-48B3.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1114-1133
0.019
2
7mer
1626-1643
0.013
2
7mer
1741-1751
0.011
2
7mer
844-867
0.009
2
6mer
340-354
0.006
3
LL22NC03-22D1.1
hsa-miR-548h-5p
0.947

Gene Details
Chromosome: 22
Transcript: ENST00000624601
Biotype: lincRNA
Gene id: ENSG00000279003
Gene Name: LL22NC03-22D1.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
25968-25986
0.011
2
7mer
1073-1087
0.006
5
7mer
9485-9502
0.005
2
7mer
2007-2026
0.004
2
6mer
17526-17539
0.004
8
7mer
10455-10466
0.003
Not Conserved
6mer
22001-22016
0.003
1
6mer
15392-15411
0.002
2
6mer
12794-12814
0.002
2
7mer
7610-7632
0.002
3
6mer
26264-26282
0.002
2
6mer
8449-8474
0.002
2
6mer
16180-16194
0.002
1
6mer
19734-19744
0.002
1
6mer
7754-7780
0.002
2
6mer
1349-1362
0.002
2
6mer
20225-20250
0.002
2
6mer
23956-23971
0.001
1
6mer
6046-6060
0.001
2
6mer
27147-27163
0.001
Not Conserved
HAND2-AS1
hsa-miR-548h-5p
0.946

Gene Details
Chromosome: 4
Transcript: ENST00000502896
Biotype: antisense
Gene id: ENSG00000237125
Gene Name: HAND2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
3935-3956
0.015
7
8mer
3722-3743
0.014
6
9mer
4012-4029
0.008
5
8mer
3167-3183
0.007
3
7mer
2767-2787
0.004
1
6mer
2491-2514
0.004
8
6mer
2796-2810
0.002
9
7mer
2252-2276
0.002
1
6mer
2584-2610
0.001
5
6mer
3797-3816
0.001
1
DLEU2
hsa-miR-548h-5p
0.945

Gene Details
Chromosome: 13
Transcript: ENST00000433070
Biotype: antisense
Gene id: ENSG00000231607
Gene Name: DLEU2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
597-618
0.040
2
7mer
67-93
0.012
1
6mer
284-307
0.005
3
XLOC_005278
hsa-miR-548h-5p
0.945

Gene Details
Chromosome: chr6
Transcript: TCONS_00011803
Biotype: transcript isomorph
Gene id: XLOC_005278
Gene Name: XLOC_005278
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
- Breast Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
5526-5543
0.028
2
8mer
976-999
0.024
7
7mer
3880-3904
0.003
2
6mer
5340-5365
0.003
2
CTB-83J4.2
hsa-miR-548h-5p
0.945

Gene Details
Chromosome: 19
Transcript: ENST00000596330
Biotype: lincRNA
Gene id: ENSG00000269271
Gene Name: CTB-83J4.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
542-548
0.040
2
6mer
437-464
0.017
2
XLOC_003240
hsa-miR-548h-5p
0.944

Gene Details
Chromosome: chr3
Transcript: TCONS_00006650
Biotype: transcript isomorph
Gene id: XLOC_003240
Gene Name: XLOC_003240
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
14-28
0.030
2
7mer
2631-2649
0.006
1
8mer
3727-3739
0.005
1
6mer
9156-9181
0.005
2
7mer
4028-4049
0.004
2
6mer
8767-8793
0.004
Not Conserved
6mer
2939-2955
0.002
1
RP11-886D15.1
hsa-miR-548h-5p
0.943

Gene Details
Chromosome: 11
Transcript: ENST00000536529
Biotype: lincRNA
Gene id: ENSG00000256422
Gene Name: RP11-886D15.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Lung Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
25-46
0.057
2
Funded by: