Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-548h-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-322E11.2
hsa-miR-548h-5p
0.933

Gene Details
Chromosome: 18
Transcript: ENST00000612496
Biotype: lincRNA
Gene id: ENSG00000275512
Gene Name: RP11-322E11.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1873-1896
0.031
2
6mer
2303-2321
0.009
2
6mer
980-984
0.007
2
6mer
627-647
0.006
1
RP11-403A3.1
hsa-miR-548h-5p
0.932

Gene Details
Chromosome: 13
Transcript: ENST00000618896
Biotype: lincRNA
Gene id: ENSG00000274331
Gene Name: RP11-403A3.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
86-109
0.033
1
7mer
222-246
0.010
2
7mer
729-744
0.006
2
6mer
346-369
0.005
1
RP11-46H11.3
hsa-miR-548h-5p
0.932

Gene Details
Chromosome: 12
Transcript: ENST00000503695
Biotype: lincRNA
Gene id: ENSG00000250790
Gene Name: RP11-46H11.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1294-1306
0.017
1
7mer
2268-2285
0.014
1
7mer
724-737
0.012
1
6mer
839-843
0.010
1
RP11-232M24.1
hsa-miR-548h-5p
0.931

Gene Details
Chromosome: 3
Transcript: ENST00000471638
Biotype: lincRNA
Gene id: ENSG00000242671
Gene Name: RP11-232M24.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1770-1786
0.031
3
7mer
1807-1821
0.011
2
8mer
864-883
0.007
3
6mer
198-214
0.005
1
RP11-734K23.9
hsa-miR-548h-5p
0.930

Gene Details
Chromosome: 2
Transcript: ENST00000612307
Biotype: lincRNA
Gene id: ENSG00000277701
Gene Name: RP11-734K23.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
453-466
0.039
1
7mer
501-523
0.014
1
AC006116.15
hsa-miR-548h-5p
0.930

Gene Details
Chromosome: 19
Transcript: ENST00000593258
Biotype: sense_intronic
Gene id: ENSG00000267429
Gene Name: AC006116.15
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
161-182
0.053
1
AC159540.1
hsa-miR-548h-5p
0.930

Gene Details
Chromosome: 2
Transcript: ENST00000594050
Biotype: lincRNA
Gene id: ENSG00000230606
Gene Name: AC159540.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
68-81
0.037
1
7mer
11-33
0.016
1
XLOC_011699
hsa-miR-548h-5p
0.930

Gene Details
Chromosome: chr16
Transcript: TCONS_00024376
Biotype: transcript isomorph
Gene id: XLOC_011699
Gene Name: XLOC_011699
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
258-274
0.053
2
RP11-282K24.3
hsa-miR-548h-5p
0.930

Gene Details
Chromosome: 12
Transcript: ENST00000501211
Biotype: sense_intronic
Gene id: ENSG00000253284
Gene Name: RP11-282K24.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3153-3176
0.013
5
6mer
5037-5041
0.008
3
7mer
296-314
0.006
1
6mer
4619-4638
0.005
3
7mer
2756-2778
0.004
1
6mer
573-599
0.003
2
7mer
2588-2599
0.003
1
6mer
4167-4194
0.003
1
6mer
986-1001
0.002
2
6mer
3762-3770
0.002
1
6mer
3933-3958
0.002
Not Conserved
6mer
3955-3971
0.001
4
ARL2-SNX15
hsa-miR-548h-5p
0.930

Gene Details
Chromosome: 11
Transcript: NR_037650.1
Biotype: sense
Gene id: NR_037650.1 (gene)
Gene Name: ARL2-SNX15
UCSC graphic: -
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2317-2344
0.043
3
6mer
314-337
0.007
9
6mer
457-472
0.003
5
CTB-186H2.3
hsa-miR-548h-5p
0.929

Gene Details
Chromosome: 17
Transcript: ENST00000612584
Biotype: antisense
Gene id: ENSG00000275431
Gene Name: CTB-186H2.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
3802-3823
0.030
2
8mer
2900-2918
0.009
2
8mer
2285-2304
0.009
3
7mer
1981-2000
0.002
1
6mer
1165-1190
0.002
1
6mer
2940-2955
0.002
2
RP11-391M1.4
hsa-miR-548h-5p
0.929

Gene Details
Chromosome: 3
Transcript: ENST00000607057
Biotype: lincRNA
Gene id: ENSG00000272452
Gene Name: RP11-391M1.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
114-130
0.027
1
7mer
1930-1955
0.025
2
XLOC_010353
hsa-miR-548h-5p
0.929

Gene Details
Chromosome: chr13
Transcript: TCONS_00021759
Biotype: transcript isomorph
Gene id: XLOC_010353
Gene Name: XLOC_010353
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3049-3065
0.020
1
7mer
2935-2962
0.013
3
6mer
2905-2929
0.009
4
7mer
496-520
0.009
4
6mer
1348-1375
0.002
2
LINC01215
hsa-miR-548h-5p
0.929

Gene Details
Chromosome: 3
Transcript: ENST00000607746
Biotype: lincRNA
Gene id: ENSG00000271856
Gene Name: LINC01215
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2372-2390
0.020
2
8mer
2396-2415
0.015
2
8mer
1862-1884
0.012
2
7mer
1447-1474
0.003
3
6mer
2162-2187
0.003
1
AC005154.6
hsa-miR-548h-5p
0.929

Gene Details
Chromosome: 7
Transcript: ENST00000584621
Biotype: antisense
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
120-133
0.028
2
7mer
29-49
0.025
2
LINC00358
hsa-miR-548h-5p
0.928

Gene Details
Chromosome: 13
Transcript: ENST00000432697
Biotype: lincRNA
Gene id: ENSG00000229578
Gene Name: LINC00358
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
237-255
0.021
3
7mer
1085-1104
0.019
2
8mer
370-387
0.012
1
CTA-125H2.2
hsa-miR-548h-5p
0.928

Gene Details
Chromosome: 22
Transcript: ENST00000609809
Biotype: antisense
Gene id: ENSG00000231933
Gene Name: CTA-125H2.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
765-787
0.044
8
7mer
491-509
0.008
3
XLOC_003440
hsa-miR-548h-5p
0.928

Gene Details
Chromosome: chr4
Transcript: TCONS_00007971
Biotype: transcript isomorph
Gene id: XLOC_003440
Gene Name: XLOC_003440
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
220-247
0.039
1
7mer
3023-3046
0.014
1
RP11-861A13.4
hsa-miR-548h-5p
0.927

Gene Details
Chromosome: 3
Transcript: NR_110030.1
Biotype: lincRNA
Gene id: NR_110030.1 (gene)
Gene Name: RP11-861A13.4
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2156-2174
0.020
2
8mer
2180-2199
0.014
2
8mer
1646-1668
0.011
2
6mer
1946-1971
0.003
1
7mer
1231-1258
0.003
3
RP11-809F4.3
hsa-miR-548h-5p
0.927

Gene Details
Chromosome: 3
Transcript: ENST00000562617
Biotype: lincRNA
Gene id: ENSG00000260217
Gene Name: RP11-809F4.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
380-399
0.047
2
6mer
748-762
0.005
1
Funded by: