Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-548h-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP5-1172N10.4
hsa-miR-548h-5p
0.918

Gene Details
Chromosome: X
Transcript: ENST00000602481
Biotype: sense_intronic
Gene id: ENSG00000269941
Gene Name: RP5-1172N10.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
595-611
0.021
10
8mer
396-405
0.020
3
6mer
339-364
0.010
10
CTA-292E10.9
hsa-miR-548h-5p
0.918

Gene Details
Chromosome: 22
Transcript: ENST00000623127
Biotype: antisense
Gene id: ENSG00000280111
Gene Name: CTA-292E10.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
4850-4872
0.009
5
8mer
8361-8385
0.006
2
8mer
4371-4397
0.005
2
9mer
11913-11926
0.005
1
7mer
23468-23486
0.004
2
6mer
12358-12370
0.003
2
6mer
18652-18656
0.003
1
6mer
22088-22104
0.002
1
6mer
13826-13847
0.002
2
6mer
17553-17572
0.002
1
6mer
12935-12945
0.002
1
6mer
14232-14255
0.002
Not Conserved
6mer
7349-7366
0.002
3
6mer
15300-15324
0.002
1
6mer
4915-4940
0.001
4
7mer
12395-12416
0.001
2
RP11-690D19.3
hsa-miR-548h-5p
0.918

Gene Details
Chromosome: 11
Transcript: ENST00000561652
Biotype: sense_overlapping
Gene id: ENSG00000260966
Gene Name: RP11-690D19.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4910-4925
0.022
3
7mer
200-225
0.013
3
6mer
4974-4995
0.007
4
6mer
4552-4567
0.005
2
6mer
714-733
0.003
2
6mer
1216-1240
0.001
3
RP11-662J14.2
hsa-miR-548h-5p
0.917

Gene Details
Chromosome: 14
Transcript: ENST00000557101
Biotype: lincRNA
Gene id: ENSG00000258480
Gene Name: RP11-662J14.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
244-262
0.045
1
6mer
366-388
0.005
1
AC159540.1
hsa-miR-548h-5p
0.916

Gene Details
Chromosome: 2
Transcript: ENST00000616719
Biotype: lincRNA
Gene id: ENSG00000230606
Gene Name: AC159540.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
65-78
0.037
1
7mer
8-30
0.013
1
MLK7-AS1
hsa-miR-548h-5p
0.915

Gene Details
Chromosome: 2
Transcript: ENST00000423106
Biotype: antisense
Gene id: ENSG00000238133
Gene Name: MLK7-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
489-504
0.020
13
6mer
276-301
0.016
10
7mer
140-145
0.012
4
6mer
1840-1859
0.003
4
AC007750.5
hsa-miR-548h-5p
0.913

Gene Details
Chromosome: 2
Transcript: NR_110255.1
Biotype: antisense
Gene id: NR_110255.1 (gene)
Gene Name: AC007750.5
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
3569-3593
0.025
2
6mer
43-47
0.007
4
7mer
2577-2594
0.006
4
6mer
15-36
0.005
1
6mer
2855-2863
0.004
2
6mer
1998-2015
0.002
4
RP11-344N10.5
hsa-miR-548h-5p
0.913

Gene Details
Chromosome: 10
Transcript: ENST00000608005
Biotype: lincRNA
Gene id: ENSG00000272630
Gene Name: RP11-344N10.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
525-531
0.018
1
9mer
1075-1102
0.017
2
7mer
2715-2727
0.010
Not Conserved
6mer
1844-1868
0.003
1
6mer
1535-1551
0.003
2
AC159540.1
hsa-miR-548h-5p
0.912

Gene Details
Chromosome: 2
Transcript: ENST00000621982
Biotype: lincRNA
Gene id: ENSG00000230606
Gene Name: AC159540.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
124-137
0.035
1
7mer
67-89
0.014
1
XLOC_011038
hsa-miR-548h-5p
0.912

Gene Details
Chromosome: chr14
Transcript: TCONS_00022755
Biotype: transcript isomorph
Gene id: XLOC_011038
Gene Name: XLOC_011038
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
319-344
0.034
10
6mer
305-323
0.015
11
EHMT1-IT1
hsa-miR-548h-5p
0.912

Gene Details
Chromosome: 9
Transcript: NR_024341.1
Biotype: sense
Gene id: NR_024341.1 (gene)
Gene Name: EHMT1-IT1
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1673-1692
0.045
2
6mer
1143-1165
0.003
1
AC159540.1
hsa-miR-548h-5p
0.911

Gene Details
Chromosome: 2
Transcript: ENST00000620023
Biotype: lincRNA
Gene id: ENSG00000230606
Gene Name: AC159540.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
124-137
0.035
1
7mer
67-89
0.014
1
XLOC_007374
hsa-miR-548h-5p
0.911

Gene Details
Chromosome: chr9
Transcript: TCONS_00016583
Biotype: transcript isomorph
Gene id: XLOC_007374
Gene Name: XLOC_007374
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
371-390
0.049
1
AC005592.3
hsa-miR-548h-5p
0.911

Gene Details
Chromosome: 5
Transcript: ENST00000566527
Biotype: lincRNA
Gene id: ENSG00000261757
Gene Name: AC005592.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
59-69
0.010
3
6mer
15-30
0.009
2
6mer
537-555
0.007
2
6mer
332-336
0.006
2
6mer
123-127
0.006
Not Conserved
6mer
1231-1239
0.006
2
6mer
1355-1374
0.005
Not Conserved
CTA-796E4.5
hsa-miR-548h-5p
0.911

Gene Details
Chromosome: 22
Transcript: ENST00000624243
Biotype: lincRNA
Gene id: ENSG00000280065
Gene Name: CTA-796E4.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
20501-20527
0.007
2
8mer
20959-20985
0.005
1
7mer
25371-25398
0.004
2
8mer
20638-20659
0.004
2
7mer
14353-14366
0.004
2
7mer
11613-11626
0.004
2
7mer
3095-3107
0.003
1
6mer
5890-5907
0.003
3
6mer
1368-1393
0.002
1
8mer
22053-22071
0.002
2
6mer
15055-15073
0.002
2
6mer
23905-23925
0.002
1
6mer
24344-24362
0.002
2
6mer
6172-6198
0.002
4
6mer
17714-17725
0.002
1
6mer
22040-22059
0.001
1
6mer
30533-30552
0.001
1
AC159540.1
hsa-miR-548h-5p
0.910

Gene Details
Chromosome: 2
Transcript: NR_103732.1
Biotype: lincRNA
Gene id: NR_103732.1 (gene)
Gene Name: AC159540.1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
359-372
0.034
1
7mer
407-429
0.014
1
TRIM36-IT1
hsa-miR-548h-5p
0.910

Gene Details
Chromosome: 5
Transcript: ENST00000503723
Biotype: sense_intronic
Gene id: ENSG00000250472
Gene Name: TRIM36-IT1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
731-754
0.020
2
7mer
714-729
0.014
2
6mer
831-850
0.006
Not Conserved
6mer
661-688
0.005
2
6mer
363-384
0.004
Not Conserved
RP11-165H23.1
hsa-miR-548h-5p
0.910

Gene Details
Chromosome: 9
Transcript: NR_109771.1
Biotype: lincRNA
Gene id: NR_109771.1 (gene)
Gene Name: RP11-165H23.1
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2335-2360
0.038
2
8mer
750-770
0.011
2
CTD-2574D22.2
hsa-miR-548h-5p
0.909

Gene Details
Chromosome: 16
Transcript: ENST00000450909
Biotype: antisense
Gene id: ENSG00000247735
Gene Name: CTD-2574D22.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1286-1312
0.024
2
8mer
1638-1650
0.020
1
6mer
400-423
0.004
4
XLOC_000393
hsa-miR-548h-5p
0.909

Gene Details
Chromosome: chr1
Transcript: TCONS_00000055
Biotype: transcript isomorph
Gene id: XLOC_000393
Gene Name: XLOC_000393
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
963-985
0.021
2
7mer
935-947
0.016
1
6mer
1119-1132
0.006
1
6mer
1259-1268
0.006
1
Funded by: