Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-548h-5p

ENST00000430057
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
WWC3-AS1
hsa-miR-548h-5p
0.384

Gene Details
Chromosome: X
Transcript: ENST00000430057
Biotype: antisense
Gene id: ENSG00000225076
Gene Name: WWC3-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
294-316
0.003
Not Conserved
Funded by: