Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-548h-5p

ENST00000499521
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
CTB-89H12.4
hsa-miR-548h-5p
0.993

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
144-169
0.015
7
7mer
709-732
0.011
10
7mer
8462-8473
0.010
2
6mer
534-551
0.009
11
6mer
559-576
0.009
11
7mer
8595-8622
0.009
1
7mer
8291-8312
0.008
5
6mer
886-896
0.005
5
7mer
4224-4247
0.005
1
6mer
5416-5439
0.004
7
7mer
1285-1311
0.004
1
7mer
2678-2697
0.003
2
6mer
4184-4202
0.001
2
Funded by: