Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-548h-5p

ENST00000501122
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
NEAT1
hsa-miR-548h-5p
0.980

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
9682-9696
0.011
3
9mer
11651-11667
0.010
1
8mer
9061-9075
0.007
2
7mer
14989-15012
0.006
3
7mer
14743-14769
0.005
3
7mer
18952-18957
0.004
2
6mer
832-853
0.004
2
8mer
9140-9152
0.003
2
6mer
18501-18528
0.003
2
6mer
6358-6381
0.002
2
6mer
7846-7863
0.002
1
7mer
19053-19066
0.002
3
6mer
15663-15686
0.002
2
6mer
8073-8081
0.002
2
7mer
9194-9218
0.002
1
6mer
3999-4023
0.002
3
6mer
15335-15352
0.002
1
6mer
16405-16421
0.002
2
6mer
18664-18678
0.002
2
6mer
8185-8200
0.002
2
6mer
18200-18226
0.001
2
6mer
8265-8283
0.001
2
Funded by: