Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-548h-5p

ENST00000517961
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AC084082.3
hsa-miR-548h-5p
0.724

Gene Details
Chromosome: 8
Transcript: ENST00000517961
Biotype: lincRNA
Gene id: ENSG00000253190
Gene Name: AC084082.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
389-405
0.022
2
6mer
763-790
0.005
2
Funded by: