Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-548h-5p

ENST00000541782
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
SCARNA10
hsa-miR-548h-5p
0.618

Gene Details
Chromosome: 12
Transcript: ENST00000541782
Biotype: sense_intronic
Gene id: ENSG00000276232
Gene Name: SCARNA10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
78-98
0.013
8
6mer
69-88
0.005
2
Funded by: