Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-548h-5p

ENST00000623130
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AC006548.28
hsa-miR-548h-5p
0.994

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
113-126
0.008
2
7mer
592-619
0.006
2
7mer
71174-71196
0.006
1
8mer
55344-55365
0.005
1
8mer
31151-31175
0.004
1
8mer
21467-21487
0.004
2
7mer
4457-4478
0.004
3
7mer
3234-3253
0.004
2
7mer
2245-2264
0.004
2
6mer
1488-1508
0.002
2
8mer
23274-23280
0.002
2
6mer
41049-41072
0.002
2
6mer
48071-48092
0.002
Not Conserved
6mer
21119-21123
0.002
1
6mer
30408-30429
0.002
2
6mer
1265-1287
0.002
2
6mer
16542-16566
0.002
2
6mer
59468-59487
0.002
2
6mer
8762-8766
0.002
1
7mer
8394-8411
0.002
1
6mer
22286-22310
0.002
2
6mer
79525-79544
0.002
Not Conserved
7mer
20631-20653
0.002
2
6mer
67452-67469
0.002
Not Conserved
6mer
56257-56278
0.002
1
6mer
73955-73979
0.002
2
6mer
36503-36523
0.002
2
6mer
65841-65864
0.002
1
6mer
16953-16964
0.001
1
6mer
63819-63837
0.001
2
6mer
75104-75130
0.001
1
6mer
20744-20767
0.001
2
6mer
23288-23303
0.001
1
6mer
67922-67943
0.001
Not Conserved
6mer
51926-51952
0.001
Not Conserved
6mer
62927-62951
0.001
2
6mer
31143-31155
0.001
2
6mer
14176-14197
0.001
1
6mer
2176-2196
0.001
2
6mer
8347-8359
0.001
Not Conserved
Funded by: