Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-548h-5p

ENST00000624945
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
MIR6818
hsa-miR-548h-5p
0.970

Gene Details
Chromosome: 22
Transcript: ENST00000624945
Biotype: antisense
Gene id: ENSG00000279159
Gene Name: MIR6818
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
146-164
0.007
1
8mer
45355-45361
0.006
1
7mer
30179-30199
0.005
11
7mer
2936-2963
0.004
6
7mer
9223-9243
0.004
2
7mer
8572-8594
0.003
2
6mer
48585-48600
0.003
2
6mer
5894-5920
0.003
4
6mer
27262-27283
0.003
4
6mer
25223-25248
0.003
7
6mer
41159-41184
0.002
5
6mer
14951-14969
0.002
4
7mer
45798-45815
0.002
2
6mer
15990-16000
0.002
2
6mer
3979-3993
0.002
2
6mer
14681-14695
0.002
1
6mer
20561-20585
0.002
2
6mer
13683-13701
0.002
3
6mer
30587-30601
0.002
2
6mer
7015-7032
0.002
2
7mer
25142-25160
0.001
3
6mer
32718-32743
0.001
1
6mer
34008-34027
0.001
2
6mer
33870-33887
0.001
2
6mer
34117-34132
0.001
1
6mer
27236-27249
0.001
2
Funded by: