Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-548h-5p

NR_024586.1
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
KMT2E-AS1
hsa-miR-548h-5p
0.870

Gene Details
Chromosome: 7
Transcript: NR_024586.1
Biotype: lincRNA
Gene id: NR_024586.1 (gene)
Gene Name: KMT2E-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
260-283
0.014
2
7mer
562-569
0.008
3
8mer
1831-1849
0.005
1
6mer
449-464
0.004
2
6mer
1245-1269
0.003
2
7mer
1090-1103
0.002
2
6mer
2313-2335
0.002
7
6mer
1113-1132
0.002
2
6mer
1236-1252
0.001
3
Funded by: