Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-548h-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_010463
hsa-miR-548h-5p
0.943

Gene Details
Chromosome: chr13
Transcript: TCONS_00021867
Biotype: transcript isomorph
Gene id: XLOC_010463
Gene Name: XLOC_010463
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
10687-10700
0.007
4
7mer
702-727
0.007
2
8mer
7454-7470
0.006
2
8mer
10077-10088
0.005
1
7mer
9769-9794
0.005
2
7mer
1289-1307
0.004
2
7mer
9480-9485
0.004
Not Conserved
6mer
645-667
0.003
4
7mer
9123-9143
0.003
2
6mer
2607-2632
0.003
2
6mer
2145-2159
0.002
2
6mer
6186-6203
0.002
1
6mer
9998-10015
0.002
2
6mer
3774-3778
0.002
2
6mer
4617-4635
0.002
1
RP11-6N13.4
hsa-miR-548h-5p
0.943

Gene Details
Chromosome: 5
Transcript: ENST00000523745
Biotype: lincRNA
Gene id: ENSG00000253776
Gene Name: RP11-6N13.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
545-563
0.057
2
RP11-81H3.2
hsa-miR-548h-5p
0.942

Gene Details
Chromosome: 12
Transcript: ENST00000548427
Biotype: lincRNA
Gene id: ENSG00000251138
Gene Name: RP11-81H3.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
9-24
0.056
1
RP11-156P1.3
hsa-miR-548h-5p
0.942

Gene Details
Chromosome: 17
Transcript: ENST00000570314
Biotype: lincRNA
Gene id: ENSG00000262879
Gene Name: RP11-156P1.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
218-242
0.056
3
RP11-775H9.3
hsa-miR-548h-5p
0.942

Gene Details
Chromosome: 4
Transcript: ENST00000569694
Biotype: lincRNA
Gene id: ENSG00000261166
Gene Name: RP11-775H9.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
996-1022
0.022
1
8mer
813-837
0.020
2
7mer
761-776
0.008
1
6mer
258-267
0.006
1
RP11-407N8.6
hsa-miR-548h-5p
0.942

Gene Details
Chromosome: 12
Transcript: ENST00000614647
Biotype: lincRNA
Gene id: ENSG00000274156
Gene Name: RP11-407N8.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
207-222
0.027
2
7mer
84-102
0.015
2
7mer
417-438
0.009
1
6mer
216-235
0.006
1
XLOC_007078
hsa-miR-548h-5p
0.941

Gene Details
Chromosome: chr8
Transcript: TCONS_00014998
Biotype: transcript isomorph
Gene id: XLOC_007078
Gene Name: XLOC_007078
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
772-795
0.043
1
6mer
552-575
0.013
2
RP11-305O6.3
hsa-miR-548h-5p
0.941

Gene Details
Chromosome: 12
Transcript: ENST00000545709
Biotype: sense_intronic
Gene id: ENSG00000250280
Gene Name: RP11-305O6.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
303-315
0.012
3
7mer
3151-3177
0.011
3
7mer
2963-2977
0.010
2
6mer
3099-3111
0.008
3
6mer
506-519
0.006
3
6mer
3115-3130
0.004
1
7mer
1799-1824
0.004
2
8mer
1828-1848
0.002
Not Conserved
RP11-274H2.5
hsa-miR-548h-5p
0.941

Gene Details
Chromosome: 3
Transcript: ENST00000567714
Biotype: sense_overlapping
Gene id: ENSG00000261051
Gene Name: RP11-274H2.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2058-2075
0.026
4
7mer
1953-1973
0.017
4
8mer
862-878
0.014
2
RP11-15B24.1
hsa-miR-548h-5p
0.940

Gene Details
Chromosome: 9
Transcript: ENST00000436084
Biotype: lincRNA
Gene id: ENSG00000225085
Gene Name: RP11-15B24.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
368-391
0.031
2
8mer
432-448
0.024
2
RP11-981P6.1
hsa-miR-548h-5p
0.939

Gene Details
Chromosome: 12
Transcript: ENST00000552778
Biotype: antisense
Gene id: ENSG00000258302
Gene Name: RP11-981P6.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1093-1117
0.019
3
7mer
788-812
0.014
2
7mer
365-392
0.012
2
7mer
1015-1032
0.010
3
RP1-205F14P.1
hsa-miR-548h-5p
0.938

Gene Details
Chromosome: 22
Transcript: ENST00000625043
Biotype: lincRNA
Gene id: ENSG00000280445
Gene Name: RP1-205F14P.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
226-242
0.043
8
6mer
256-270
0.012
7
RP11-347J14.7
hsa-miR-548h-5p
0.938

Gene Details
Chromosome: 9
Transcript: ENST00000423499
Biotype: lincRNA
Gene id: ENSG00000231140
Gene Name: RP11-347J14.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Lung Normal/Primary
- Ovary Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4-19
0.043
Not Conserved
6mer
188-203
0.012
1
AC159540.1
hsa-miR-548h-5p
0.937

Gene Details
Chromosome: 2
Transcript: ENST00000618277
Biotype: lincRNA
Gene id: ENSG00000230606
Gene Name: AC159540.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
65-78
0.039
1
7mer
8-30
0.016
1
XLOC_011494
hsa-miR-548h-5p
0.937

Gene Details
Chromosome: chr15
Transcript: TCONS_00024132
Biotype: transcript isomorph
Gene id: XLOC_011494
Gene Name: XLOC_011494
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
302-318
0.055
2
NNT-AS1
hsa-miR-548h-5p
0.936

Gene Details
Chromosome: 5
Transcript: ENST00000506247
Biotype: antisense
Gene id: ENSG00000248092
Gene Name: NNT-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
28-53
0.055
1
LINC00342
hsa-miR-548h-5p
0.936

Gene Details
Chromosome: 2
Transcript: ENST00000412393
Biotype: lincRNA
Gene id: ENSG00000232931
Gene Name: LINC00342
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
68-81
0.038
1
7mer
11-34
0.017
1
RP11-531A24.3
hsa-miR-548h-5p
0.935

Gene Details
Chromosome: 8
Transcript: ENST00000564832
Biotype: lincRNA
Gene id: ENSG00000260838
Gene Name: RP11-531A24.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
3187-3208
0.020
4
8mer
490-509
0.013
4
7mer
2811-2828
0.010
4
6mer
2625-2651
0.006
5
7mer
479-499
0.006
Not Conserved
XLOC_001718
hsa-miR-548h-5p
0.934

Gene Details
Chromosome: chr2
Transcript: TCONS_00003913
Biotype: transcript isomorph
Gene id: XLOC_001718
Gene Name: XLOC_001718
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Colon Normal/Primary
- Heart Normal/Primary
- Skeletal Muscle Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1464-1473
0.029
11
8mer
1397-1417
0.020
4
6mer
888-909
0.005
6
RP11-314D7.1
hsa-miR-548h-5p
0.934

Gene Details
Chromosome: 12
Transcript: ENST00000551135
Biotype: lincRNA
Gene id: ENSG00000258294
Gene Name: RP11-314D7.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
76-97
0.054
11
Funded by: