Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-548h-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-734K23.9
hsa-miR-548h-5p
0.926

Gene Details
Chromosome: 2
Transcript: ENST00000618066
Biotype: lincRNA
Gene id: ENSG00000277701
Gene Name: RP11-734K23.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
588-601
0.037
1
7mer
636-658
0.015
1
RP11-734K23.9
hsa-miR-548h-5p
0.926

Gene Details
Chromosome: 2
Transcript: ENST00000621110
Biotype: lincRNA
Gene id: ENSG00000277701
Gene Name: RP11-734K23.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
618-631
0.037
1
7mer
666-688
0.015
1
XLOC_013174
hsa-miR-548h-5p
0.926

Gene Details
Chromosome: chr19
Transcript: TCONS_00027635
Biotype: transcript isomorph
Gene id: XLOC_013174
Gene Name: XLOC_013174
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1249-1273
0.025
1
7mer
844-870
0.017
1
6mer
873-897
0.011
1
RP11-820L6.1
hsa-miR-548h-5p
0.925

Gene Details
Chromosome: 11
Transcript: ENST00000527474
Biotype: lincRNA
Gene id: ENSG00000255090
Gene Name: RP11-820L6.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
888-907
0.052
10
LINC00342
hsa-miR-548h-5p
0.925

Gene Details
Chromosome: 2
Transcript: NR_103734.1
Biotype: lincRNA
Gene id: NR_103734.1 (gene)
Gene Name: LINC00342
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
134-147
0.035
1
7mer
77-100
0.016
1
RP5-1074L1.4
hsa-miR-548h-5p
0.924

Gene Details
Chromosome: 1
Transcript: ENST00000609909
Biotype: antisense
Gene id: ENSG00000273373
Gene Name: RP5-1074L1.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
64-84
0.028
1
8mer
2089-2115
0.011
2
6mer
2579-2604
0.006
3
6mer
2268-2287
0.003
1
6mer
2152-2168
0.003
3
RP3-395M20.9
hsa-miR-548h-5p
0.924

Gene Details
Chromosome: 1
Transcript: ENST00000424215
Biotype: antisense
Gene id: ENSG00000228037
Gene Name: RP3-395M20.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
499-518
0.030
1
6mer
452-466
0.021
2
LINC01189
hsa-miR-548h-5p
0.923

Gene Details
Chromosome: 9
Transcript: ENST00000428440
Biotype: lincRNA
Gene id: ENSG00000232827
Gene Name: LINC01189
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
543-555
0.033
1
6mer
905-924
0.010
2
6mer
1254-1260
0.004
1
6mer
2298-2307
0.004
1
RP11-63M22.2
hsa-miR-548h-5p
0.923

Gene Details
Chromosome: 16
Transcript: ENST00000569274
Biotype: antisense
Gene id: ENSG00000260465
Gene Name: RP11-63M22.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
538-559
0.035
9
8mer
135-155
0.016
1
RP11-527H14.1
hsa-miR-548h-5p
0.923

Gene Details
Chromosome: 18
Transcript: ENST00000583306
Biotype: lincRNA
Gene id: ENSG00000263821
Gene Name: RP11-527H14.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
134-159
0.044
2
7mer
193-198
0.008
Not Conserved
RP11-401F2.3
hsa-miR-548h-5p
0.923

Gene Details
Chromosome: 17
Transcript: ENST00000585193
Biotype: antisense
Gene id: ENSG00000266473
Gene Name: RP11-401F2.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
305-323
0.051
9
RP11-15H20.6
hsa-miR-548h-5p
0.922

Gene Details
Chromosome: 19
Transcript: ENST00000601239
Biotype: retained_intron
Gene id: ENSG00000213971
Gene Name: RP11-15H20.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
607-622
0.014
2
7mer
1573-1592
0.013
2
6mer
534-560
0.010
2
6mer
62-88
0.009
1
6mer
1552-1570
0.006
2
XLOC_002543
hsa-miR-548h-5p
0.922

Gene Details
Chromosome: chr2
Transcript: TCONS_00004629
Biotype: transcript isomorph
Gene id: XLOC_002543
Gene Name: XLOC_002543
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Skeletal Muscle Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
25-43
0.018
1
7mer
45-58
0.014
1
7mer
1548-1561
0.007
2
7mer
232-245
0.006
2
6mer
124-142
0.006
2
6mer
2000-2023
0.001
1
AC139099.6
hsa-miR-548h-5p
0.922

Gene Details
Chromosome: 17
Transcript: ENST00000574856
Biotype: lincRNA
Gene id: ENSG00000262952
Gene Name: AC139099.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
325-340
0.040
2
7mer
258-270
0.011
1
NUTM2B-AS1
hsa-miR-548h-5p
0.920

Gene Details
Chromosome: 10
Transcript: ENST00000619625
Biotype: antisense
Gene id: ENSG00000225484
Gene Name: NUTM2B-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
512-517
0.010
3
9mer
3609-3629
0.010
2
6mer
11-30
0.008
2
6mer
7446-7461
0.005
1
6mer
7375-7397
0.004
1
6mer
3226-3250
0.003
2
7mer
5257-5270
0.003
2
6mer
5974-5995
0.002
2
6mer
2172-2196
0.002
1
6mer
3751-3776
0.002
Not Conserved
7mer
2164-2179
0.001
2
XLOC_012296
hsa-miR-548h-5p
0.920

Gene Details
Chromosome: chr17
Transcript: TCONS_00025127
Biotype: transcript isomorph
Gene id: XLOC_012296
Gene Name: XLOC_012296
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Breast Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
937-961
0.018
2
9mer
419-437
0.014
4
6mer
240-256
0.012
7
7mer
39-65
0.007
1
LINC01028
hsa-miR-548h-5p
0.920

Gene Details
Chromosome: 17
Transcript: ENST00000586373
Biotype: lincRNA
Gene id: ENSG00000267603
Gene Name: LINC01028
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
937-961
0.018
2
9mer
419-437
0.014
4
6mer
240-256
0.012
7
7mer
39-65
0.007
1
ALMS1-IT1
hsa-miR-548h-5p
0.920

Gene Details
Chromosome: 2
Transcript: NR_046762.1
Biotype: sense
Gene id: NR_046762.1 (gene)
Gene Name: ALMS1-IT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1415-1433
0.018
2
7mer
121-126
0.014
2
6mer
335-350
0.013
2
6mer
419-438
0.006
1
RP11-317M11.1
hsa-miR-548h-5p
0.919

Gene Details
Chromosome: 4
Transcript: ENST00000508112
Biotype: sense_intronic
Gene id: ENSG00000249341
Gene Name: RP11-317M11.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1279-1298
0.024
1
8mer
925-944
0.017
2
7mer
950-960
0.009
3
PTENP1-AS
hsa-miR-548h-5p
0.919

Gene Details
Chromosome: 9
Transcript: NR_103745.1
Biotype: lincRNA
Gene id: NR_103745.1 (gene)
Gene Name: PTENP1-AS
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
514-541
0.027
2
7mer
252-278
0.012
1
7mer
365-386
0.012
1
Funded by: