Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-582-3p

ENST00000432154
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-407B7.1
hsa-miR-582-3p
0.423

Gene Details
Chromosome: 3
Transcript: ENST00000432154
Biotype: lincRNA
Gene id: ENSG00000230102
Gene Name: RP11-407B7.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1333-1347
0.002
2
6mer
1401-1411
0.002
2
6mer
1178-1194
0.001
1
Funded by: