Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-582-3p

ENST00000499227
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-382J12.1
hsa-miR-582-3p
0.457

Gene Details
Chromosome: 8
Transcript: ENST00000499227
Biotype: antisense
Gene id: ENSG00000246366
Gene Name: RP11-382J12.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
849-871
0.004
2
6mer
174-193
0.003
2
6mer
2246-2268
0.001
2
Funded by: