Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-582-3p

ENST00000623726
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP5-1014D13.2
hsa-miR-582-3p
0.592

Gene Details
Chromosome: 22
Transcript: ENST00000623726
Biotype: sense_overlapping
Gene id: ENSG00000279738
Gene Name: RP5-1014D13.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
554-568
0.003
1
7mer
17200-17221
0.003
3
6mer
16808-16827
0.002
2
6mer
1683-1692
0.002
3
6mer
12407-12425
0.001
2
6mer
8800-8809
0.001
2
6mer
17857-17875
0.001
4
6mer
7905-7926
0.001
2
6mer
14059-14070
0.001
1
6mer
1439-1462
0.001
1
Funded by: