Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-582-3p

NR_024091.1
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
ZFP91-CNTF
hsa-miR-582-3p
0.545

Gene Details
Chromosome: 11
Transcript: NR_024091.1
Biotype: sense
Gene id: NR_024091.1 (gene)
Gene Name: ZFP91-CNTF
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-582-3p
Sequence: uaacugguugaacaacugaacc
MirBase ID: MIMAT0004797
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1439-1456
0.009
11
6mer
459-482
0.003
2
6mer
2329-2338
0.002
3
Funded by: