Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_004419
hsa-miR-641
0.901

Gene Details
Chromosome: chr5
Transcript: TCONS_00010710
Biotype: transcript isomorph
Gene id: XLOC_004419
Gene Name: XLOC_004419
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
61-76
0.022
2
7mer
1792-1811
0.015
1
6mer
682-699
0.006
1
6mer
864-882
0.003
1
AC007349.5
hsa-miR-641
0.900

Gene Details
Chromosome: 7
Transcript: ENST00000415356
Biotype: lincRNA
Gene id: ENSG00000235728
Gene Name: AC007349.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
450-463
0.025
1
7mer
728-737
0.016
2
7mer
553-571
0.006
2
UG0898H09
hsa-miR-641
0.899

Gene Details
Chromosome: 8
Transcript: ENST00000623646
Biotype: lincRNA
Gene id: ENSG00000274956
Gene Name: UG0898H09
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
6781-6807
0.038
5
6mer
2136-2150
0.002
9
6mer
5608-5622
0.002
2
6mer
2084-2100
0.001
1
6mer
3126-3150
0.001
2
7mer
2095-2122
0.001
2
6mer
2092-2116
0.001
2
RP11-556E13.1
hsa-miR-641
0.899

Gene Details
Chromosome: 10
Transcript: ENST00000448017
Biotype: antisense
Gene id: ENSG00000228651
Gene Name: RP11-556E13.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
40-53
0.038
1
6mer
271-288
0.008
3
XLOC_008274
hsa-miR-641
0.898

Gene Details
Chromosome: chrY
Transcript: TCONS_00017605
Biotype: transcript isomorph
Gene id: XLOC_008274
Gene Name: XLOC_008274
UCSC graphic: -
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
5244-5264
0.012
2
7mer
701-722
0.008
1
8mer
3976-3989
0.007
2
7mer
1502-1525
0.005
2
6mer
876-900
0.005
2
6mer
620-642
0.004
2
6mer
610-628
0.003
1
6mer
1346-1366
0.002
1
6mer
1361-1377
0.001
Not Conserved
CASC11
hsa-miR-641
0.897

Gene Details
Chromosome: 8
Transcript: ENST00000502463
Biotype: lincRNA
Gene id: ENSG00000249375
Gene Name: CASC11
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2681-2703
0.027
3
8mer
334-353
0.017
2
6mer
1112-1122
0.003
2
XLOC_007217
hsa-miR-641
0.896

Gene Details
Chromosome: chr8
Transcript: TCONS_00014535
Biotype: transcript isomorph
Gene id: XLOC_007217
Gene Name: XLOC_007217
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2679-2701
0.027
3
8mer
332-351
0.016
2
6mer
1110-1120
0.003
2
AL050303.7
hsa-miR-641
0.895

Gene Details
Chromosome: 21
Transcript: ENST00000444356
Biotype: lincRNA
Gene id: ENSG00000224922
Gene Name: AL050303.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
259-285
0.046
3
SERTAD4-AS1
hsa-miR-641
0.895

Gene Details
Chromosome: 1
Transcript: NR_024337.1
Biotype: antisense
Gene id: NR_024337.1 (gene)
Gene Name: SERTAD4-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
691-714
0.033
2
7mer
754-780
0.013
7
CH507-210P18.5
hsa-miR-641
0.895

Gene Details
Chromosome: 21
Transcript: ENST00000623720
Biotype: lincRNA
Gene id: ENSG00000279751
Gene Name: CH507-210P18.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
259-285
0.046
3
XLOC_003678
hsa-miR-641
0.894

Gene Details
Chromosome: chr4
Transcript: TCONS_00008216
Biotype: transcript isomorph
Gene id: XLOC_003678
Gene Name: XLOC_003678
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
19-40
0.046
2
LINC01091
hsa-miR-641
0.893

Gene Details
Chromosome: 4
Transcript: ENST00000515769
Biotype: lincRNA
Gene id: ENSG00000249464
Gene Name: LINC01091
UCSC graphic:
Expression:
  Cell Line Tissue Category
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2049-2070
0.039
2
7mer
837-856
0.006
Not Conserved
XLOC_011950
hsa-miR-641
0.893

Gene Details
Chromosome: chr16
Transcript: TCONS_00024662
Biotype: transcript isomorph
Gene id: XLOC_011950
Gene Name: XLOC_011950
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
A549 Lung Cancer/Malignant
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
974-999
0.044
6
6mer
1525-1546
0.001
4
XLOC_004366
hsa-miR-641
0.892

Gene Details
Chromosome: chr5
Transcript: TCONS_00009941
Biotype: transcript isomorph
Gene id: XLOC_004366
Gene Name: XLOC_004366
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
13850-13855
0.012
1
8mer
4094-4120
0.010
1
7mer
1956-1969
0.007
2
7mer
11660-11682
0.004
2
7mer
7769-7789
0.003
1
6mer
8187-8206
0.003
2
6mer
5905-5931
0.002
1
6mer
4966-4981
0.002
1
6mer
5678-5690
0.001
1
6mer
7456-7479
0.001
1
XLOC_006725
hsa-miR-641
0.892

Gene Details
Chromosome: chr8
Transcript: TCONS_00014630
Biotype: transcript isomorph
Gene id: XLOC_006725
Gene Name: XLOC_006725
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
785-799
0.029
2
7mer
622-646
0.008
3
7mer
483-500
0.008
2
ITPR1-AS1
hsa-miR-641
0.892

Gene Details
Chromosome: 3
Transcript: ENST00000412804
Biotype: antisense
Gene id: ENSG00000231249
Gene Name: ITPR1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
73-89
0.031
2
7mer
559-582
0.010
4
6mer
117-132
0.004
3
RP11-156E6.1
hsa-miR-641
0.892

Gene Details
Chromosome: 17
Transcript: ENST00000560400
Biotype: sense_overlapping
Gene id: ENSG00000259623
Gene Name: RP11-156E6.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
724-741
0.015
6
7mer
373-394
0.013
3
7mer
2588-2614
0.012
4
6mer
1968-1991
0.004
8
RP1-309I22.2
hsa-miR-641
0.891

Gene Details
Chromosome: 22
Transcript: ENST00000624184
Biotype: sense_overlapping
Gene id: ENSG00000279338
Gene Name: RP1-309I22.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
14358-14375
0.013
9
8mer
23461-23486
0.005
5
6mer
26244-26260
0.004
11
7mer
20200-20213
0.003
1
7mer
3470-3490
0.003
2
6mer
13366-13387
0.002
3
7mer
25643-25668
0.002
2
6mer
24821-24836
0.002
3
6mer
15514-15537
0.002
2
6mer
9092-9097
0.002
2
6mer
24992-25019
0.002
3
6mer
5532-5559
0.002
4
6mer
1362-1379
0.001
2
6mer
7187-7201
0.001
1
6mer
20945-20967
0.001
2
6mer
25806-25817
0.001
2
LINC00299
hsa-miR-641
0.891

Gene Details
Chromosome: 2
Transcript: ENST00000442956
Biotype: lincRNA
Gene id: ENSG00000236790
Gene Name: LINC00299
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Lung Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
182-197
0.024
Not Conserved
6mer
192-216
0.006
1
7mer
412-434
0.006
2
6mer
448-466
0.005
1
6mer
404-422
0.003
2
XLOC_007173
hsa-miR-641
0.890

Gene Details
Chromosome: chr8
Transcript: TCONS_00015119
Biotype: transcript isomorph
Gene id: XLOC_007173
Gene Name: XLOC_007173
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
141-158
0.032
2
6mer
870-887
0.003
Not Conserved
6mer
1497-1519
0.003
3
6mer
3122-3136
0.002
3
6mer
2498-2517
0.002
1
7mer
2102-2125
0.001
1
6mer
1409-1428
0.001
1
6mer
2059-2082
0.001
1
Funded by: