Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-661P17.1
hsa-miR-641
0.994

Gene Details
Chromosome: 15
Transcript: ENST00000554333
Biotype: lincRNA
Gene id: ENSG00000258551
Gene Name: RP11-661P17.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2104-2131
0.043
2
7mer
1314-1339
0.021
3
7mer
1975-2000
0.019
3
7mer
384-400
0.011
2
RP11-661P17.1
hsa-miR-641
0.993

Gene Details
Chromosome: 15
Transcript: NR_110106.1
Biotype: lincRNA
Gene id: NR_110106.1 (gene)
Gene Name: RP11-661P17.1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2102-2129
0.042
2
7mer
1312-1337
0.021
3
7mer
1973-1998
0.019
3
7mer
382-398
0.011
2
XLOC_011353
hsa-miR-641
0.993

Gene Details
Chromosome: chr15
Transcript: TCONS_00023240
Biotype: transcript isomorph
Gene id: XLOC_011353
Gene Name: XLOC_011353
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Ovary Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2102-2129
0.042
2
7mer
1312-1337
0.021
3
7mer
1973-1998
0.019
3
7mer
382-398
0.011
2
XLOC_001338
hsa-miR-641
0.993

Gene Details
Chromosome: chr2
Transcript: TCONS_00003564
Biotype: transcript isomorph
Gene id: XLOC_001338
Gene Name: XLOC_001338
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
907-932
0.058
3
8mer
225-251
0.015
2
8mer
103-121
0.011
1
8mer
160-186
0.008
Not Conserved
RP11-182L21.6
hsa-miR-641
0.993

Gene Details
Chromosome: 10
Transcript: ENST00000605920
Biotype: lincRNA
Gene id: ENSG00000272447
Gene Name: RP11-182L21.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1611-1635
0.072
1
7mer
1279-1305
0.020
1
CRNDE
hsa-miR-641
0.993

Gene Details
Chromosome: 16
Transcript: ENST00000501177
Biotype: lincRNA
Gene id: ENSG00000245694
Gene Name: CRNDE
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
50-75
0.092
6
RP11-586K12.10
hsa-miR-641
0.993

Gene Details
Chromosome: 16
Transcript: ENST00000570183
Biotype: lincRNA
Gene id: ENSG00000260311
Gene Name: RP11-586K12.10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
461-485
0.048
1
6mer
2073-2092
0.015
1
6mer
1655-1676
0.011
1
6mer
1320-1335
0.010
1
6mer
915-928
0.008
1
TTTY15
hsa-miR-641
0.993

Gene Details
Chromosome: Y
Transcript: NR_001545.2
Biotype: lincRNA
Gene id: NR_001545.2 (gene)
Gene Name: TTTY15
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
117-143
0.019
1
6mer
4999-5024
0.019
1
6mer
4827-4831
0.015
1
7mer
3678-3695
0.014
1
7mer
2120-2141
0.009
1
7mer
2602-2625
0.008
1
6mer
3326-3352
0.007
1
RP11-1437A8.4
hsa-miR-641
0.992

Gene Details
Chromosome: 16
Transcript: ENST00000563960
Biotype: lincRNA
Gene id: ENSG00000260827
Gene Name: RP11-1437A8.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2002-2026
0.048
1
6mer
395-414
0.014
1
6mer
811-832
0.011
1
6mer
1152-1167
0.009
1
6mer
1559-1572
0.008
1
KCNQ1OT1
hsa-miR-641
0.990

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
67231-67254
0.016
2
7mer
68626-68645
0.011
5
7mer
56558-56580
0.008
7
7mer
75723-75738
0.005
2
7mer
5547-5571
0.005
1
7mer
69251-69271
0.004
2
6mer
52936-52956
0.003
2
7mer
68895-68913
0.003
2
7mer
58150-58166
0.003
1
6mer
44131-44155
0.003
7
6mer
14389-14409
0.003
2
7mer
46701-46723
0.003
2
6mer
86351-86376
0.003
4
6mer
89940-89959
0.003
2
7mer
90363-90386
0.002
1
7mer
86580-86597
0.002
1
6mer
2627-2647
0.002
2
6mer
62360-62381
0.002
2
6mer
46479-46500
0.002
1
6mer
35749-35769
0.002
1
7mer
70959-70982
0.001
2
6mer
81103-81128
0.001
2
6mer
68591-68606
0.001
1
CTA-342B11.3
hsa-miR-641
0.990

Gene Details
Chromosome: 22
Transcript: ENST00000624235
Biotype: lincRNA
Gene id: ENSG00000280370
Gene Name: CTA-342B11.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
978-994
0.022
1
9mer
11638-11656
0.013
2
9mer
12481-12497
0.009
1
8mer
12589-12613
0.005
1
7mer
3233-3247
0.005
3
7mer
4328-4338
0.004
2
9mer
20927-20951
0.004
1
7mer
21730-21750
0.003
Not Conserved
7mer
5333-5352
0.003
1
6mer
5247-5274
0.002
3
7mer
22261-22272
0.002
Not Conserved
6mer
20814-20836
0.002
1
6mer
8733-8747
0.002
1
6mer
14313-14330
0.002
2
6mer
3444-3470
0.002
1
7mer
12176-12192
0.002
2
6mer
12121-12145
0.001
2
6mer
3761-3782
0.001
2
6mer
11098-11119
0.001
1
6mer
5382-5407
0.001
2
XLOC_003316
hsa-miR-641
0.990

Gene Details
Chromosome: chr3
Transcript: TCONS_00005474
Biotype: transcript isomorph
Gene id: XLOC_003316
Gene Name: XLOC_003316
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
419-441
0.041
1
8mer
161-179
0.026
2
7mer
1468-1495
0.011
2
8mer
370-389
0.008
2
CTA-929C8.9
hsa-miR-641
0.989

Gene Details
Chromosome: 22
Transcript: ENST00000624278
Biotype: sense_intronic
Gene id: ENSG00000279185
Gene Name: CTA-929C8.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
13199-13215
0.009
2
7mer
12832-12855
0.008
2
7mer
6810-6833
0.006
2
6mer
24260-24277
0.004
3
7mer
14665-14685
0.004
2
8mer
14788-14815
0.004
1
7mer
18295-18310
0.004
1
7mer
708-731
0.004
2
7mer
9299-9326
0.003
2
7mer
992-1012
0.003
2
7mer
3941-3964
0.003
2
7mer
14529-14546
0.003
3
7mer
13381-13397
0.003
1
7mer
12907-12922
0.003
3
6mer
11605-11624
0.002
1
6mer
12110-12128
0.002
2
7mer
10611-10635
0.002
Not Conserved
6mer
13998-14006
0.002
2
6mer
16404-16419
0.002
2
7mer
4742-4759
0.002
1
6mer
7076-7093
0.002
1
6mer
7865-7871
0.002
1
6mer
13730-13746
0.002
2
7mer
16407-16427
0.001
2
6mer
19096-19113
0.001
1
6mer
2882-2906
0.001
1
6mer
10636-10660
0.001
2
6mer
15537-15560
0.001
1
6mer
13255-13281
0.001
2
6mer
7942-7962
0.001
2
6mer
14857-14880
0.001
1
PWAR6
hsa-miR-641
0.989

Gene Details
Chromosome: 15
Transcript: ENST00000552334
Biotype: lincRNA
Gene id: ENSG00000257151
Gene Name: PWAR6
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
53-73
0.049
3
7mer
921-941
0.010
2
7mer
2615-2637
0.008
2
8mer
1022-1034
0.007
1
6mer
124-147
0.006
2
7mer
2377-2401
0.003
2
6mer
2878-2897
0.001
1
6mer
2930-2950
0.001
2
XLOC_001751
hsa-miR-641
0.989

Gene Details
Chromosome: chr2
Transcript: TCONS_00003048
Biotype: transcript isomorph
Gene id: XLOC_001751
Gene Name: XLOC_001751
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2151-2175
0.063
2
9mer
462-477
0.021
1
CTC-459F4.3
hsa-miR-641
0.987

Gene Details
Chromosome: 19
Transcript: ENST00000588784
Biotype: lincRNA
Gene id: ENSG00000267575
Gene Name: CTC-459F4.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2074-2092
0.056
1
6mer
346-366
0.017
1
6mer
1203-1223
0.009
1
XLOC_013093
hsa-miR-641
0.987

Gene Details
Chromosome: chr19
Transcript: TCONS_00027051
Biotype: transcript isomorph
Gene id: XLOC_013093
Gene Name: XLOC_013093
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
3100-3112
0.035
2
7mer
3099-3104
0.019
1
6mer
176-202
0.010
2
6mer
744-760
0.005
2
6mer
841-855
0.005
2
6mer
678-689
0.004
1
6mer
1714-1726
0.004
2
RP11-297M9.2
hsa-miR-641
0.987

Gene Details
Chromosome: 16
Transcript: ENST00000562861
Biotype: lincRNA
Gene id: ENSG00000260432
Gene Name: RP11-297M9.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
187-210
0.043
8
7mer
423-439
0.009
2
6mer
203-227
0.008
7
6mer
4393-4413
0.006
2
7mer
1514-1525
0.005
8
8mer
2147-2167
0.004
2
7mer
1391-1416
0.003
1
6mer
2437-2454
0.002
2
RP11-15H20.6
hsa-miR-641
0.986

Gene Details
Chromosome: 19
Transcript: ENST00000397094
Biotype: lincRNA
Gene id: ENSG00000213971
Gene Name: RP11-15H20.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1213-1234
0.060
2
6mer
40-64
0.021
2
RP11-342A23.2
hsa-miR-641
0.986

Gene Details
Chromosome: 15
Transcript: ENST00000616099
Biotype: sense_intronic
Gene id: ENSG00000274128
Gene Name: RP11-342A23.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
333-356
0.051
Not Conserved
9mer
100-114
0.029
2
Funded by: