Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-387A1.5
hsa-miR-641
0.986

Gene Details
Chromosome: 2
Transcript: ENST00000608941
Biotype: antisense
Gene id: ENSG00000272729
Gene Name: RP11-387A1.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
88-109
0.080
8
CTA-941F9.10
hsa-miR-641
0.985

Gene Details
Chromosome: 22
Transcript: ENST00000623075
Biotype: sense_overlapping
Gene id: ENSG00000280383
Gene Name: CTA-941F9.10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
22539-22562
0.011
4
8mer
4568-4587
0.010
1
7mer
21955-21971
0.008
3
6mer
22972-22993
0.008
7
7mer
7261-7287
0.007
2
7mer
2690-2709
0.006
1
7mer
13821-13848
0.004
Not Conserved
6mer
60-71
0.004
Not Conserved
8mer
7360-7383
0.004
Not Conserved
7mer
17433-17460
0.003
2
7mer
7313-7329
0.002
2
7mer
7299-7323
0.002
2
6mer
18139-18157
0.002
2
6mer
13243-13269
0.002
4
6mer
18814-18829
0.002
2
6mer
4084-4106
0.002
1
6mer
8325-8336
0.002
2
6mer
18994-19017
0.001
2
RP11-728E14.3
hsa-miR-641
0.985

Gene Details
Chromosome: 17
Transcript: ENST00000577309
Biotype: lincRNA
Gene id: ENSG00000265043
Gene Name: RP11-728E14.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2859-2885
0.042
2
6mer
45-62
0.023
2
6mer
1584-1601
0.007
2
7mer
2736-2757
0.005
1
6mer
2640-2662
0.002
1
XLOC_010279
hsa-miR-641
0.984

Gene Details
Chromosome: chr12
Transcript: TCONS_00020261
Biotype: transcript isomorph
Gene id: XLOC_010279
Gene Name: XLOC_010279
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
85-105
0.078
1
XLOC_013703
hsa-miR-641
0.984

Gene Details
Chromosome: chr20
Transcript: TCONS_00028028
Biotype: transcript isomorph
Gene id: XLOC_013703
Gene Name: XLOC_013703
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2106-2120
0.078
1
RP3-323A16.1
hsa-miR-641
0.983

Gene Details
Chromosome: 22
Transcript: ENST00000623959
Biotype: antisense
Gene id: ENSG00000279184
Gene Name: RP3-323A16.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
50403-50421
0.011
Not Conserved
9mer
4463-4482
0.009
1
9mer
40048-40068
0.007
1
7mer
29135-29155
0.005
2
8mer
21057-21074
0.004
1
7mer
9796-9808
0.004
1
7mer
47561-47578
0.004
1
7mer
35171-35190
0.004
2
7mer
22319-22341
0.003
4
7mer
13386-13400
0.003
1
6mer
41771-41790
0.002
3
6mer
10743-10764
0.002
1
6mer
2182-2200
0.002
3
7mer
17956-17975
0.002
2
6mer
28327-28342
0.002
1
6mer
36358-36382
0.002
4
6mer
25874-25885
0.002
1
6mer
37794-37809
0.002
2
6mer
46303-46311
0.001
1
7mer
38786-38811
0.001
2
6mer
22712-22724
0.001
2
6mer
15123-15144
0.001
2
6mer
38190-38201
0.001
2
6mer
17594-17610
0.001
6
6mer
41144-41171
0.001
Not Conserved
LINC00972
hsa-miR-641
0.983

Gene Details
Chromosome: 7
Transcript: ENST00000422448
Biotype: lincRNA
Gene id: ENSG00000225128
Gene Name: LINC00972
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
435-453
0.068
2
6mer
472-479
0.009
1
AC002519.8
hsa-miR-641
0.982

Gene Details
Chromosome: 16
Transcript: ENST00000570073
Biotype: sense_intronic
Gene id: ENSG00000259810
Gene Name: AC002519.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1660-1686
0.018
2
6mer
20-41
0.017
2
7mer
241-256
0.015
1
7mer
355-380
0.014
1
6mer
484-508
0.012
2
TEX41
hsa-miR-641
0.981

Gene Details
Chromosome: 2
Transcript: ENST00000597655
Biotype: lincRNA
Gene id: ENSG00000226674
Gene Name: TEX41
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
778-800
0.031
2
9mer
313-331
0.024
2
7mer
188-202
0.014
5
6mer
162-178
0.006
4
RP11-757G1.6
hsa-miR-641
0.980

Gene Details
Chromosome: 11
Transcript: ENST00000512200
Biotype: lincRNA
Gene id: ENSG00000250508
Gene Name: RP11-757G1.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
251-263
0.059
1
6mer
1795-1814
0.008
1
6mer
1301-1328
0.007
1
TEX41
hsa-miR-641
0.980

Gene Details
Chromosome: 2
Transcript: ENST00000596540
Biotype: lincRNA
Gene id: ENSG00000226674
Gene Name: TEX41
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
816-838
0.026
2
9mer
295-313
0.023
2
7mer
170-184
0.015
5
6mer
144-160
0.006
4
6mer
763-772
0.004
2
LINC00972
hsa-miR-641
0.979

Gene Details
Chromosome: 7
Transcript: ENST00000438065
Biotype: lincRNA
Gene id: ENSG00000225128
Gene Name: LINC00972
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
677-695
0.066
2
6mer
714-721
0.008
1
RP11-477N3.1
hsa-miR-641
0.977

Gene Details
Chromosome: 2
Transcript: ENST00000606436
Biotype: lincRNA
Gene id: ENSG00000272156
Gene Name: RP11-477N3.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
673-692
0.046
1
8mer
83-97
0.026
3
RP1-136B1.1
hsa-miR-641
0.977

Gene Details
Chromosome: 6
Transcript: ENST00000606542
Biotype: lincRNA
Gene id: ENSG00000272465
Gene Name: RP1-136B1.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
326-350
0.059
3
7mer
672-694
0.013
2
TTTY16
hsa-miR-641
0.976

Gene Details
Chromosome: Y
Transcript: ENST00000437686
Biotype: lincRNA
Gene id: ENSG00000225520
Gene Name: TTTY16
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
26-50
0.071
1
XLOC_011368
hsa-miR-641
0.976

Gene Details
Chromosome: chr15
Transcript: TCONS_00023532
Biotype: transcript isomorph
Gene id: XLOC_011368
Gene Name: XLOC_011368
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3279-3301
0.061
1
6mer
189-208
0.004
1
6mer
485-504
0.004
1
6mer
2300-2320
0.002
6
XLOC_013174
hsa-miR-641
0.976

Gene Details
Chromosome: chr19
Transcript: TCONS_00027635
Biotype: transcript isomorph
Gene id: XLOC_013174
Gene Name: XLOC_013174
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
992-1019
0.023
1
7mer
483-507
0.020
1
7mer
873-890
0.015
1
6mer
623-636
0.013
1
RP11-13E5.2
hsa-miR-641
0.975

Gene Details
Chromosome: X
Transcript: ENST00000438994
Biotype: lincRNA
Gene id: ENSG00000237208
Gene Name: RP11-13E5.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
532-558
0.066
2
6mer
190-200
0.004
1
IPW
hsa-miR-641
0.975

Gene Details
Chromosome: 15
Transcript: NR_023915.1
Biotype: lincRNA
Gene id: NR_023915.1 (gene)
Gene Name: IPW
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
20-39
0.040
2
9mer
2774-2800
0.020
5
6mer
2086-2107
0.008
7
6mer
753-761
0.003
Not Conserved
XLOC_011185
hsa-miR-641
0.974

Gene Details
Chromosome: chr15
Transcript: TCONS_00023184
Biotype: transcript isomorph
Gene id: XLOC_011185
Gene Name: XLOC_011185
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
20-39
0.040
2
9mer
2774-2800
0.020
5
6mer
2086-2107
0.008
7
6mer
753-761
0.003
Not Conserved
Funded by: